Explain the classes of enzymes, Biology

Assignment Help:

System of classification

The Enzyme Commission divided enzymes into 6 main classes, on the basis of the total reaction catalyzed. Each enzyme was assigned a code number; consisting of four elements, separated by dots. The first digit shows to which of the main classes the enzyme belongs, as follows:

First digit    Enzyme class                Type of reaction catalyzed

1                  Oxido-reductases           Oxidation/reduction reactions

2                  Transferases                 Transfer of an atom or group between two molecules.

3                  Hydrolases                     Hydrolysis reactions

4                  Lyases                          Removal of a group from substrate (not be hydrolysis)

5                 Isomerases                    Isomerization reactions

6                 Ligases                            The synthetic joining of two molecule.

 


Related Discussions:- Explain the classes of enzymes

How to calculate the biological value of protein, How to Calculate the Biol...

How to Calculate the Biological Value of Protein? A method for determining the biological value of proteins was developed by Mitchell in 1925. It measures the quantity of dieta

Bovine rotavirus diarrhoea, Bovine rotavirus diarrhoea The bovine rota...

Bovine rotavirus diarrhoea The bovine rotavirus is a RNA virus with 11 segments of double stranded RNA belonging to the genus Rotavirus in the family Reoviridae. Rotaviruses c

Echocardiography, Echocardiography: LV hypertrophy can be identified using ...

Echocardiography: LV hypertrophy can be identified using M-Mode and 2 D imaging. Indications of myocardial ischemic states and systolic functions can be assessed by studying region

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Noise exposures - factors affecting occupational health, Noise Exposures - ...

Noise Exposures - Factors Affecting Occupational Health Various equipment and processes generate noise of varying intensity and - frequency. In this respect ventilation system

Atp, what is atp explain in detail?

what is atp explain in detail?

Determine the different types of sensory receptors, Determine the different...

Determine the different types of sensory receptors There are different types of sensory receptors as follows:  Visual receptors in the eyes for vision.  Auditory receptor

Define iron requirements of school children and adolescents, Define Iron re...

Define Iron requirements of school children and adolescents? The iron requirements are also computed by factorial method and should therefore add iron requirement of maintenanc

Fatty acid metabolism, Fatty Acid Metabolism The body has a limited sup...

Fatty Acid Metabolism The body has a limited supply of glucose associative to the energy stored as fat. There are 3 sources of fatty acids for energy metabolism within animals;

Procedure for spore staining in a given bacterial culture, Explain Procedur...

Explain Procedure for Spore Staining in a Given Bacterial Culture Carry out the exercise following the steps enumerated herewith 1. Take a clean, non-greasy slide. Prepare b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd