Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
System of classification
The Enzyme Commission divided enzymes into 6 main classes, on the basis of the total reaction catalyzed. Each enzyme was assigned a code number; consisting of four elements, separated by dots. The first digit shows to which of the main classes the enzyme belongs, as follows:
First digit Enzyme class Type of reaction catalyzed
1 Oxido-reductases Oxidation/reduction reactions
2 Transferases Transfer of an atom or group between two molecules.
3 Hydrolases Hydrolysis reactions
4 Lyases Removal of a group from substrate (not be hydrolysis)
5 Isomerases Isomerization reactions
6 Ligases The synthetic joining of two molecule.
How to Calculate the Biological Value of Protein? A method for determining the biological value of proteins was developed by Mitchell in 1925. It measures the quantity of dieta
Bovine rotavirus diarrhoea The bovine rotavirus is a RNA virus with 11 segments of double stranded RNA belonging to the genus Rotavirus in the family Reoviridae. Rotaviruses c
Echocardiography: LV hypertrophy can be identified using M-Mode and 2 D imaging. Indications of myocardial ischemic states and systolic functions can be assessed by studying region
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Noise Exposures - Factors Affecting Occupational Health Various equipment and processes generate noise of varying intensity and - frequency. In this respect ventilation system
what is atp explain in detail?
Determine the different types of sensory receptors There are different types of sensory receptors as follows: Visual receptors in the eyes for vision. Auditory receptor
Define Iron requirements of school children and adolescents? The iron requirements are also computed by factorial method and should therefore add iron requirement of maintenanc
Fatty Acid Metabolism The body has a limited supply of glucose associative to the energy stored as fat. There are 3 sources of fatty acids for energy metabolism within animals;
Explain Procedure for Spore Staining in a Given Bacterial Culture Carry out the exercise following the steps enumerated herewith 1. Take a clean, non-greasy slide. Prepare b
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd