Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the cell cycle in details?
Most cells of higher organisms follow a cyclic pattern of division. The bulk of the cycle consists of the stage known as interphase, the period of cell growth and development. Interphase begins with a period of cell growth, which is called G1. In G1 the newly divided cell roughly doubles in size and in number of organelles.
The S-phase following G1 is when the fully developed cell undergoes DNA synthesis, or replication of DNA to form two identical sets, each of which will go to one of the daughter cells. DNA is located within the nucleus in the form of chromatin, combined with proteins called histones.
The gap, or growth phase called G2, follows. Most of G2 is involved in synthesis of proteins and other structures necessary for mitosis, or in the separation of the duplicated DNA strands, and no DNA is synthesized in G2.
During mitosis, strands of chromatin condense to form chromosomes, and the cell divides. Each chromosome contains a single linear molecule of helical DNA. The actual division of the cytoplasm and the cell itself is called cytokinesis. A new G1 or growth phase follows, and the cycle is repeated.
Adaptive radiation: The growth of a variety of species from the single ancestral form; occurs when a new habitat becomes accessible to a population. The evolutionary pattern of di
Amiodarone, quinidine, propafenone, and verapamil may increase digoxin levels up to 100 per cent. It is prudent to measure a blood level after 7-14 days (and at least 6 hours after
what are the modes of nutrition in different animals
The important functional characteristics of soy protein The most important functional characteristics of soy protein concentrates are water-binding (water adsorption) capacity,
What is the mechanism by which the neural impulse is transmitted along the axon? The neural impulse is transmitted with the neuronal membrane through depolarization of consecu
what is mean by autotrophic ?
Parasitic Protozoan Out of the thousands of species of Protozoa, the majority are free living. However, many species from within the phyla Sarcomastigophora and Ciliophora are
Define beriefly about the Phytoestrogens? You may be aware of the surging interest in phytoestrogens (PE) especially in connection with osteoporosis. This section briefly discu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is agamospermy? How is agamospermy dissimilar from parthenogenesis and parthenocarpy? i. How can haploid plants be increased in the laboratory? ii. Name the plant f
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd