Explain the cell cycle in details, Biology

Assignment Help:

Explain the cell cycle in details?

Most cells of higher organisms follow a cyclic pattern of division. The bulk of the cycle consists of the stage known as interphase, the period of cell growth and development. Interphase begins with a period of cell growth, which is called G1. In G1 the newly divided cell roughly doubles in size and in number of organelles.

The S-phase following G1 is when the fully developed cell undergoes DNA synthesis, or replication of DNA to form two identical sets, each of which will go to one of the daughter cells. DNA is located within the nucleus in the form of chromatin, combined with proteins called histones.

The gap, or growth phase called G2, follows. Most of G2 is involved in synthesis of proteins and other structures necessary for mitosis, or in the separation of the duplicated DNA strands, and no DNA is synthesized in G2.

During mitosis, strands of chromatin condense to form chromosomes, and the cell divides. Each chromosome contains a single linear molecule of helical DNA. The actual division of the cytoplasm and the cell itself is called cytokinesis. A new G1 or growth phase follows, and the cycle is repeated.

543_cell cycle.png


Related Discussions:- Explain the cell cycle in details

Explain adaptive radiation, Adaptive radiation: The growth of a variety of...

Adaptive radiation: The growth of a variety of species from the single ancestral form; occurs when a new habitat becomes accessible to a population. The evolutionary pattern of di

Drug interactions, Amiodarone, quinidine, propafenone, and verapamil may in...

Amiodarone, quinidine, propafenone, and verapamil may increase digoxin levels up to 100 per cent. It is prudent to measure a blood level after 7-14 days (and at least 6 hours after

What is the important characteristics of soy protein, The important functio...

The important functional characteristics of soy protein The most important functional characteristics of soy protein concentrates are water-binding (water adsorption) capacity,

The neural impulse is transmitted along the axon, What is the mechanism by ...

What is the mechanism by which the neural impulse is transmitted along the axon? The neural impulse is transmitted with the neuronal membrane through depolarization of consecu

Parasitic protozoan, Parasitic Protozoan Out of the thousands of speci...

Parasitic Protozoan Out of the thousands of species of Protozoa, the majority are free living. However, many species from within the phyla Sarcomastigophora and Ciliophora are

Define beriefly about the phytoestrogens, Define beriefly about the Phytoes...

Define beriefly about the Phytoestrogens? You may be aware of the surging interest in phytoestrogens (PE) especially in connection with osteoporosis. This section briefly discu

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is agamospermy, What is agamospermy? How is agamospermy dissimila...

What is agamospermy? How is agamospermy dissimilar from parthenogenesis and parthenocarpy? i. How can haploid plants be increased in the laboratory? ii. Name the plant f

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd