Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Bohr's model?
Bohr's Model : Electrons move around the nucleus at tremendous speeds and occupy most of the space in an atom. The exact position or location of an electron at any given moment can only be predicted on the basis of probability. In a widely accepted model of the atom originally proposed by Neils Bohr, electrons move in spherical spaces called orbitals, or shells, which correspond to different energy levels. Electrons are distributed according to their energy levels, with the higher energy electrons residing in the outer shells. The innermost shell contains only 2 electrons. In common elements, the next outer shells contain 8 electrons each.
Atoms either gain, lose, or share electrons in the outer shells. Because the outer shells of many atoms are incomplete, most atoms will interact with other atoms during chemical reactions to achieve stable outer shells. The number of electrons that an atom must either gain, lose, or share to complete the outer shell is known as its valence, or oxidation number. For example, carbon has six electrons, two in its first energy level and four in the outer level. Thus, it can form a stable outer shell by gaining, losing, or sharing four electrons to complete its outer shell when it joins, or bonds, with another atom or atoms to form a compound. The following table lists the oxidation numbers of some important ions frequently used in Biology.
Explain Arterial Switch Operation Surgery? This is the operation of choice for simple transposition of the great arteries as it ensures anatomical correction. The approach is t
Features of Amphibian Gastrulation Major features of amphibian gastrulation are: Ectoderm surrounds the embryo by Epiboly. Gastrulation is initiated by a limited i
What is the most excellent identification hypothesis for a plant tissue seen under the microscope having most cells undergoing cell division? The most excellent hypothesis is t
Which two of the following changes (a - d) usually tend to occur in the plain dwellers when they move to high altitudes (3,500 m or more)? 1. Enhance in red blood cell size 2
An incubation combination is set up having the single-stranded DNA template, DNA polymerase I, the primer and all 4 deoxyribonucleoside triphosphates (dTTP, dGTP, dCTP, dATP),
Unacceptable Aesthetics The implant which has successfully integrated with bone may still be a failure if the Prosthesis which it is designed to support does not meet with the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain about the Food product development? Food product development is often commodity related. This type of research needs to be carried out in the pilot plants with the equi
Explain nutritional properties of the eggs Drying of eggs under normal conditions causes little loss of the nutritional properties of the eggs. Vitamin A, vitamin B, thiamine,
Caution for the use of Pipettes - Food Microbiology? (1) Never do pipetting with mouth. (2) For culturing, sterilized pipettes should be used. (3) Never keep pipettes on
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd