Explain the bohr''s model, Biology

Assignment Help:

Explain the Bohr's model?

Bohr's Model :  Electrons move around the nucleus at tremendous speeds and occupy most of the space in an atom. The exact position or location of an electron at any given moment can only be predicted on the basis of probability.
In a widely accepted model of the atom originally proposed by Neils Bohr, electrons move in spherical spaces called orbitals, or shells, which correspond to different energy levels. Electrons are distributed according to their energy levels, with the higher energy electrons residing in the outer shells.
The innermost shell contains only 2 electrons. In common elements, the next outer shells contain 8 electrons each.

1355_bohr model.png

Atoms either gain, lose, or share electrons in the outer shells. Because the outer shells of many atoms are incomplete, most atoms will interact with other atoms during chemical reactions to achieve stable outer shells.
The number of electrons that an atom must either gain, lose, or share to complete the outer shell is known as its valence, or oxidation number. For example, carbon has six electrons, two in its first energy level and four in the outer level. Thus, it can form a stable outer shell by gaining, losing, or sharing four electrons to complete its outer shell when it joins, or bonds, with another atom or atoms to form a compound.
The following table lists the oxidation numbers of some important ions frequently used in Biology.

1576_table bohr model.png


Related Discussions:- Explain the bohr''s model

Chordal sparing operation- mitral valve replacement, Chordal Sparing ...

Chordal Sparing Operation : For sparing both leaflets, an incision is made on the anterior leaflet close to the annulus and then extended centrally and the two segments,

Phylum placozoa, Phylum Placozoa The phylum Placozoa contains a single...

Phylum Placozoa The phylum Placozoa contains a single species of a minute marine animal Trichoplax adharens composed of a dorsal and ventral epithelial layer enclosing loose m

Explain gelation - function of proteins, Explain Gelation - Function of pro...

Explain Gelation - Function of proteins Gelation  refers to the process where denatured molecules aggregate to form an ordered protein network. Proteins  can form a well-order

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define advantages of colonies obtained at different dilution, Define Advant...

Define Advantages of Colonies Obtained At Different Dilution 1. As colonies grow both on the surface and beneath the agar surface, so aerobes facultative anaerobes and non-stri

Why iodine is important for human body, Why Iodine is Important for Human B...

Why Iodine is Important for Human Body? Iodine is an essential constituent of the thyroid hormones: thyroxine (T 4 ) and triiodothyronine (T 3 ), which have a key role in growt

Darwins theory of natural selection, Darwins theory of natural selection is...

Darwins theory of natural selection is considered a paradigm shift--a theory that has wide-ranging effects. Describe some of the advantages that this theory offered scientists once

What do biomass pyramids represent, What do biomass pyramids represent? ...

What do biomass pyramids represent? The Biomass pyramids represent the sum of the masses of the individuals that participate in each trophic level of a food chain.

Erysipelas, E r y s i p e l a s A sudden onset of infection wi...

E r y s i p e l a s A sudden onset of infection with the bacterium E rysipelothrix insidiosa ( E . rhusiopathiae ) is seen in turkeys and increasingly in free-rang

Define erythropoietin, Erythropoietin (EPO) A. acts by increasing the p...

Erythropoietin (EPO) A. acts by increasing the production of red blood cells by cells in the bone marrow. B. is secreted by peritubular interstitial cells of the kidney cort

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd