Explain the bohr''s model, Biology

Assignment Help:

Explain the Bohr's model?

Bohr's Model :  Electrons move around the nucleus at tremendous speeds and occupy most of the space in an atom. The exact position or location of an electron at any given moment can only be predicted on the basis of probability.
In a widely accepted model of the atom originally proposed by Neils Bohr, electrons move in spherical spaces called orbitals, or shells, which correspond to different energy levels. Electrons are distributed according to their energy levels, with the higher energy electrons residing in the outer shells.
The innermost shell contains only 2 electrons. In common elements, the next outer shells contain 8 electrons each.

1355_bohr model.png

Atoms either gain, lose, or share electrons in the outer shells. Because the outer shells of many atoms are incomplete, most atoms will interact with other atoms during chemical reactions to achieve stable outer shells.
The number of electrons that an atom must either gain, lose, or share to complete the outer shell is known as its valence, or oxidation number. For example, carbon has six electrons, two in its first energy level and four in the outer level. Thus, it can form a stable outer shell by gaining, losing, or sharing four electrons to complete its outer shell when it joins, or bonds, with another atom or atoms to form a compound.
The following table lists the oxidation numbers of some important ions frequently used in Biology.

1576_table bohr model.png


Related Discussions:- Explain the bohr''s model

Explain arterial switch operation surgery, Explain Arterial Switch Operatio...

Explain Arterial Switch Operation Surgery? This is the operation of choice for simple transposition of the great arteries as it ensures anatomical correction. The approach is t

Features of amphibian gastrulation, Features of Amphibian Gastrulation ...

Features of Amphibian Gastrulation Major features of amphibian gastrulation are: Ectoderm surrounds the embryo by Epiboly. Gastrulation is initiated by a limited i

Excellent identification hypothesis for a plant tissue, What is the most ex...

What is the most excellent identification hypothesis for a plant tissue seen under the microscope having most cells undergoing cell division? The most excellent hypothesis is t

Explain plain dwellers, Which two of the following changes (a - d) usually ...

Which two of the following changes (a - d) usually tend to occur in the plain dwellers when they move to high altitudes (3,500 m or more)? 1. Enhance in red blood cell size 2

Chain termination method, An incubation  combination  is set up having  the...

An incubation  combination  is set up having  the single-stranded  DNA template, DNA polymerase  I, the primer and all 4 deoxyribonucleoside triphosphates (dTTP, dGTP, dCTP, dATP),

Explain unacceptable aesthetics, Unacceptable Aesthetics The implant wh...

Unacceptable Aesthetics The implant which has successfully integrated with bone may still be a failure if the Prosthesis which it is designed to support does not meet with the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the food product development, Explain about the Food product ...

Explain about the Food product development? Food product development is often commodity related. This type of research needs to be carried out in the pilot plants with the equi

Explain nutritional properties of the eggs, Explain nutritional properties ...

Explain nutritional properties of the eggs Drying of eggs under normal conditions causes little loss of the nutritional properties of the eggs. Vitamin A, vitamin B, thiamine,

Define caution for the use of pipettes - food microbiology, Caution for the...

Caution for the use of Pipettes - Food Microbiology? (1) Never do pipetting with mouth. (2) For culturing, sterilized pipettes should be used. (3) Never keep pipettes on

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd