Explain the birth in human biology, Biology

Assignment Help:

Explain the Birth in human biology?

In humans, birth of the infant occurs about 270 days after conception.

The period during which the uterus contracts to expel the newborn and the placenta is called labor. Sometimes, the first sign of labor is the rupture of the amnion and loss of amniotic fluid. The fluid escapes through the vagina. This is commonly referred to as when someone's "water breaks."

The beginning of labor is triggered by several stimuli. Toward the end of the third trimester of pregnancy, estrogen is produced in larger amounts, stimulating contractions of uterine muscle. The pituitary glands of both mother and fetus secrete oxytocin, that also stimulates uterine contraction. During this stage of labor, uterine contractions pull the cervix open (dilation) until it is large enough to allow the baby to pass through.

During the second stage, the baby's head moves into the vagina and is visible from the outside. As soon as the baby is out of the birth canal, it can breathe and can be independent of the mother's circulation, which is when the umbilical cord can be clamped and cut. The placenta and fetal membranes are expelled a few minutes to an hour after birth.

 


Related Discussions:- Explain the birth in human biology

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain pollination and its types, Q. What is the pollination? What are the...

Q. What is the pollination? What are the major forms of pollination? The procedure in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gameto

Cell interactions and ooplasmic determinants, Cell Interactions and Ooplasm...

Cell Interactions and Ooplasmic Determinants Microscopic observations of egg cytoplasm suggests that it is not homogenous in appearance. The observable variations in the cytop

Changes in the conformation - qualitative changes, Changes in the conformat...

Changes in the conformation of molecules - Qualitative Changes You may recall that linear chain of amino acids of a protein folds into a characteristic structure. Acidic resid

Minerals and trace elements, Minerals and Trace Elements Oxygen, carbo...

Minerals and Trace Elements Oxygen, carbon, hydrogen and nitrogen are the most common elements that make up 96% of the total weight of a mammal. The next most abundant element

What is the structure of the adult fern, What is the structure of the adult...

What is the structure of the adult fern within which cells undergoing meiosis can be found? In these plants meiosis takes place within structures known as sorus (plural, sori),

Muscles of the legs contribute to the venous return, Q. How do the muscles ...

Q. How do the muscles of the legs and of the feet contribute to the venous return? The muscles of the legs mainly the muscles of the calves compress and contract the deep veins

How are mammals characterized, Q. Mammal identity card. How are mammals cha...

Q. Mammal identity card. How are mammals characterized according to examples of representing beings, skin, respiration, nitrogen waste, basic morphology, circulation, thermal contr

Heart output, HEAR T OUTPUT The amount of blood pumped by heart per...

HEAR T OUTPUT The amount of blood pumped by heart per minute. Heart beat is 72. Pump out blood is 70 ml. This 72 × 70 = 5040 ml. ( 5 litres) blood is pumped in a minute.

Why do protease-supplying cells of the stomach, Q Why do protease-supplying...

Q Why do protease-supplying cells of the stomach and of the pancreas make only precursors of the active proteolytic enzymes? The stomach and the pancreas make zymogens of the p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd