Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Birth in human biology?
In humans, birth of the infant occurs about 270 days after conception.
The period during which the uterus contracts to expel the newborn and the placenta is called labor. Sometimes, the first sign of labor is the rupture of the amnion and loss of amniotic fluid. The fluid escapes through the vagina. This is commonly referred to as when someone's "water breaks."
The beginning of labor is triggered by several stimuli. Toward the end of the third trimester of pregnancy, estrogen is produced in larger amounts, stimulating contractions of uterine muscle. The pituitary glands of both mother and fetus secrete oxytocin, that also stimulates uterine contraction. During this stage of labor, uterine contractions pull the cervix open (dilation) until it is large enough to allow the baby to pass through.
During the second stage, the baby's head moves into the vagina and is visible from the outside. As soon as the baby is out of the birth canal, it can breathe and can be independent of the mother's circulation, which is when the umbilical cord can be clamped and cut. The placenta and fetal membranes are expelled a few minutes to an hour after birth.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the pollination? What are the major forms of pollination? The procedure in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gameto
Cell Interactions and Ooplasmic Determinants Microscopic observations of egg cytoplasm suggests that it is not homogenous in appearance. The observable variations in the cytop
Changes in the conformation of molecules - Qualitative Changes You may recall that linear chain of amino acids of a protein folds into a characteristic structure. Acidic resid
Minerals and Trace Elements Oxygen, carbon, hydrogen and nitrogen are the most common elements that make up 96% of the total weight of a mammal. The next most abundant element
What is the structure of the adult fern within which cells undergoing meiosis can be found? In these plants meiosis takes place within structures known as sorus (plural, sori),
Q. How do the muscles of the legs and of the feet contribute to the venous return? The muscles of the legs mainly the muscles of the calves compress and contract the deep veins
Q. Mammal identity card. How are mammals characterized according to examples of representing beings, skin, respiration, nitrogen waste, basic morphology, circulation, thermal contr
HEAR T OUTPUT The amount of blood pumped by heart per minute. Heart beat is 72. Pump out blood is 70 ml. This 72 × 70 = 5040 ml. ( 5 litres) blood is pumped in a minute.
Q Why do protease-supplying cells of the stomach and of the pancreas make only precursors of the active proteolytic enzymes? The stomach and the pancreas make zymogens of the p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd