Explain the basic working of cellular functioning, Biology

Assignment Help:

Q Which is the biological molecule that holds the genetic information that is transmitted hereditarily and controls the cellular functioning?

The hereditary molecule that controls the cellular functioning is the DNA deoxyribonucleic acid the DNA contains information for protein synthesis in cells.


Related Discussions:- Explain the basic working of cellular functioning

Where is the gall bladder located, Where is the gall bladder located? T...

Where is the gall bladder located? The gall bladder is located in the Upper Right Quadrant (URQ) of the abdomen just below the liver. It keeps bile secreted by the liver. The d

Individuals with tyrosinenmia, Individuals with tyrosinenmia have food patt...

Individuals with tyrosinenmia have food patterns very similar to the one for PKU discussed above. PKU is more common than tyrosinemia. Foods that are high in tyrosine and phenylala

Essential for photosynthesis, Aim : To prove that light is essential for ph...

Aim : To prove that light is essential for photosynthesis. Apparatus : A potted plant, a light screen, beaker, iodine solution. Procedure : Keep a potted plant in darkness for tw

Use of protective eyewear as personal protective equipment, Q. Use of Prote...

Q. Use of Protective Eyewear as personal protective equipment? Protective lenses must be worn by dental personnel: 1. when performing procedures that can cause spatter or ae

Types of hormones, T ypes of hormones - (i) Releasing and Inhibitory ...

T ypes of hormones - (i) Releasing and Inhibitory hormones - Hormones of hypothalamus and kidney (renin) which control secretion of trophic hormones. (ii) Trophic hormon

Define bacterial photosynthesis, Cyanobacteria carry out photosynthesis usi...

Cyanobacteria carry out photosynthesis using two photosystems as in green plants. Furthermore, other photosynthetic bacteria, like as the purple photosynthetic bacterium Rhodospiri

What are the dietary guidelines for gastritis, Q. What are the dietary guid...

Q. What are the dietary guidelines for gastritis? Energy: Give adequate calories through frequent feedings or else proteins would be utilized for energy of repair work. P

Heparin, HE P ARIN It is highly sulphated mucopolysaccharide made ...

HE P ARIN It is highly sulphated mucopolysaccharide made of alternate units of glucosamine and glucuronic acid. Heparin is mainly produced by liver and mast cells. I

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Can the cooler have had any effect, Write down any other possible explanati...

Write down any other possible explanations you think of.could the cooler have had any effect? Could something in the water be reasonable? Could there be an object in the water that

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd