Explain the basic concept of proteins, Biology

Assignment Help:

Explain the Basic Concept of Proteins?

Proteins, as we already knows by now are products of amino acids. Each molecule of protein is composed of many molecules of amino acids joined by peptide bond as can be seen in Figure.

542_Explain the Basic Concept of Proteins.png

Figure: Peptide bond formation

Proteins contain nitrogen in addition to carbon, hydrogen, oxygen and some other elements like sulphur. Thus determination of nitrogen is commonly used to determine the protein content of a sample. Proteins contain about 16% nitrogen and multiplying the nitrogen content by a factor of 6.25 gives us the amount of crude protein present in the given sample.


Related Discussions:- Explain the basic concept of proteins

What is the turnover number of the enzyme, Hydrolytic driving force. The hy...

Hydrolytic driving force. The hydrolysis of pyrophosphate to orthophosphate is important in driving forwards biosynthetic reactions such as the synthesis of DNA. THis hydrolytic re

Transgenics considered a threat to the environmental safety, Q. Why are tra...

Q. Why are transgenics considered a threat to the environmental safety? The Transgenics can be dangerous to the whole biosphere since the transfer of genes between species may

Define the disturbances in fluid balance, Define the Disturbances in Fluid ...

Define the Disturbances in Fluid Balance? The correct functioning of cells and tissues depends on appropriate concentrations of nutrients; so any abnormal loss or accumulation

Name the classes into which the phylum arthropoda is divided, What are the ...

What are the classes into which the phylum Arthropoda is divided? What are the three main ones and some of their representative species? The three major classes of arthropods a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Importance value index (ivi) - synthetic characters, Importance Value Index...

Importance Value Index (IVI) - Synthetic Characters In any study of community, the quantitative value of each of the frequency density, and cover has its own importance. But t

Explain pullulan, Pullulan Pullulan is a water soluble edible microbial...

Pullulan Pullulan is a water soluble edible microbial polysaccharide consisting of Maltotriose units (α 1 → 6), as shown in  the figure 2.12. It is produced by yeast  Aureobasi

Define role of polyunsaturated fatty acids - gene expression, Define Role o...

Define Role of polyunsaturated fatty acids - Gene Expression? In contrast, polyunsaturated fatty acids (PUFA) inhibit G6PD in both intact animals and in primary hepatocytes in

Explain what is fungi, Explain what is Fungi? The fungi are spore-beari...

Explain what is Fungi? The fungi are spore-bearing eukaryotic organisms without chlorophyll and having absorptive nutrition. These reproduce sexually as well asexually. Primari

Clinic blood pressure management, Raised blood pressure is a major risk fac...

Raised blood pressure is a major risk factor for cardiovascular disease. The higher the blood pressure, the higher the risk of stroke, coronary heart disease, kidney disease, heart

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd