Explain the alterations occurring in egg, Biology

Assignment Help:

Alterations occurring in egg

The quality, flavour, composition and functional properties of eggs are adversely affected more rapidly and to a greater extent by the speed and conditions of handling, uncoated shells, storage times and temperatures.

The nutritive value of frozen and dried eggs is essentially the same as that of fresh eggs.  The drying or freezing processes do not cause any significant loss of nutrients.  Properly stored, dried and frozen eggs show no subsequent nutrient loss.  This observation can be substantiated by the following facts. 

 

 


Related Discussions:- Explain the alterations occurring in egg

What is a terrestrial organism, Explain what is a terrestrial organism? ...

Explain what is a terrestrial organism? Ans) 'Terra' is the Latin word for earth. Thus, an animal that lives on the surface of the earth is known as terrestrial. This is the si

Amino acid, Amino acid is any of a class of 20 molecules which are combine...

Amino acid is any of a class of 20 molecules which are combined to form the proteins in living things. Consisting of the general formula NH2-CHR-COOH, where "R" is the side chain

Platyhelminthes, tell me the general characters of monopisthocotylea

tell me the general characters of monopisthocotylea

Assessment of peripheral vascular disorders - history, Assessment of Periph...

Assessment of Peripheral Vascular Disorders History Obtain the following information by interviewing the patient and family members Previous vascular surgery, previ

Identical chromatids bound, What is the structure that maintains identical ...

What is the structure that maintains identical chromatids bound? Ans) The structure that handles identical chromatids bound is the centromere.

Class of coclentrata, ????? # 100 ??????????? #Minimum ?????? ?????

????? # 100 ??????????? #Minimum ?????? ?????

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about g-protein, Explain about G-protein   A.  When an agonist ...

Explain about G-protein   A.  When an agonist binds to the binding site of a G-protein-coupled receptor (GPCR), this leads to GTP displacing a GDP bound to the alpha subunit of

State the term - psychophysiology, State the term - Psychophysiology Th...

State the term - Psychophysiology This refers to the study of psychological theories using physiological measures. In other words, psycho-physiologists normally try to understa

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd