Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Techniques for Broken Instrument Removal Described by Gary Carr
Staging platform (cutting in flat surface)
a) Create straight line access to separated file using modified Gates Glidden bur or Light speed NiTi file that ground at their maximum cross sectional diameter
b) Create circumferential staging platform by modified GG
c) Ultrasonic tip placed in staging platform between the file and the canal wall in counter-clockwise direction to unscrew file and vibrate it.
Which disease is associated with the following symptoms? Sudden onset of profuse watery stool followed by vomiting, rapid dehydration and muscular cramps?
Phenylketonuria is a severe form of mental disability caused by a homozygous recessive allele. The condition affects about 1 in 10,000 neborn Caucasians. Estimate the frequency of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is arthropods?
In humans, maleness or femaleness is determined by a pair of sex chromosomes called X and Y. (a) What is the genotype for males? (b) What is the genot
The cell membrane is produced of lipids, proteins and carbohydrates. The membrane lipids are phospholipids, a particular type of lipid to which one extremity a phosphate group i
The biological conversion of atmospheric nitrogen into ammonia in the group of plants known as legumes (peas, beans lentils and clover etc.) is achieved by the action of soil bacte
What is the function of the antidiuretic hormone? Where is it made and which are the stimuli that enhance or decrease its secretion? The antidiuretic hormone is secreted by the
What are stomata? How do these structures participate in the plant transpiration? Stomata (singular, stoma) are small specialized passages for water and gases there in the epid
what is its working
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd