Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
For a somatic cell with 2n = 4, which of the following is true?
(Note: G1- growth phase 1, G2 - growth phase 2, M - metaphase, P - prophase and T - telophase)
a. (Number of chromatids)G2 = 4; (Number of chromosomes)G1 = 4
b. (Number of chromatids)G1 = 8; (Number of sister chromatids)T = 8
c. (Number of chromatids)P = 8; (Number of chromosomes)G2 = 4
d. (Number of chromatids)G2 = 4; (Number of chromosomes)M = 8
Effects of Noise - Noise Pollution Noise can affect in the following three ways: Interferes with communication, Diminishes hearing and Affects health and even
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Energy requirements to get ideal body weight? Calories: The energy requirements of adult patients is governed by their present body weight and the need to maintain a desira
The next set of lectures in this course cover a number of topics including fermenter design, power consumption, oxygen transfer and mixing. The aim of these lectures is to underst
Q. Describe False Negaive Tests? When patients are found to have significant coronary narrowing and fail to have exercise induced ST depression, they have been labeled false ne
define fringing reef
Getting ready to grow bacteria Secure two or three dozen shallow glass dishes. The glass coasters used to stay bed castors from marring floors will do. Cut 5 cm squares of wind
The phases of the cardiac cycle are: 1) Atrial Systole This begins with the P-wave of the ECG. The atrio-ventricular valves are open and the ventricles are relaxed (diastole
Define Preoperative Care Prior to Endodontic Microsurgery a.Thorough medical history "consultation and permission from the physician is the patient has systemic disease(s) and
Define Guidelines of School Children and Adolescents? 1) Do not skip breakfast. At least have milk, fruit and cereal. Some children prefer to flavour the milk with cereal or pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd