Explain somatic cell, Biology

Assignment Help:

For a somatic cell with 2n = 4, which of the following is true?

(Note: G1- growth phase 1, G2 - growth phase 2, M - metaphase, P - prophase and T - telophase)

a.  (Number of chromatids)G2 = 4; (Number of chromosomes)G1 = 4

b.  (Number of chromatids)G1 = 8; (Number of sister chromatids)T = 8

c.  (Number of chromatids)P = 8; (Number of chromosomes)G2 = 4

d.  (Number of chromatids)G2 = 4; (Number of chromosomes)M = 8

 


Related Discussions:- Explain somatic cell

Effects of noise - noise pollution, Effects of Noise - Noise Pollution ...

Effects of Noise - Noise Pollution Noise can affect in the following three ways: Interferes with communication, Diminishes hearing and Affects health and even

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Energy requirements to get ideal body weight, Q. Energy requirements to get...

Q. Energy requirements to get ideal body weight? Calories: The energy requirements of adult patients is governed by their present body weight and the need to maintain a desira

Stirred tank reactors, The next set of lectures in this course cover a num...

The next set of lectures in this course cover a number of topics including fermenter design, power consumption, oxygen transfer and mixing. The aim of these lectures is to underst

Describe false negaive tests, Q. Describe False Negaive Tests? When pat...

Q. Describe False Negaive Tests? When patients are found to have significant coronary narrowing and fail to have exercise induced ST depression, they have been labeled false ne

Getting ready to grow bacteria, Getting ready to grow bacteria Secure t...

Getting ready to grow bacteria Secure two or three dozen shallow glass dishes. The glass coasters used to stay bed castors from marring floors will do. Cut 5 cm squares of wind

Phases of the cardiac cycle, The phases of the cardiac cycle are: 1)  At...

The phases of the cardiac cycle are: 1)  Atrial Systole This begins with the P-wave of the ECG. The atrio-ventricular valves are open and the ventricles are relaxed (diastole

Define preoperative care prior to endodontic microsurgery, Define Preoperat...

Define Preoperative Care Prior to Endodontic Microsurgery a.Thorough medical history "consultation and permission from the physician is the patient has systemic disease(s) and

Define guidelines of school children and adolescents, Define Guidelines of ...

Define Guidelines of School Children and Adolescents? 1) Do not skip breakfast. At least have milk, fruit and cereal. Some children prefer to flavour the milk with cereal or pr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd