Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Explain Shannon-Wiener index?
This diversity measure is based on information theory of measure of order (or disorder) within a particular system. For our uses, this order could be characterized by the number and/or the number of individuals in each species, within our sample plot. By applying these numbers to the Shannon-Wiener equations we can determine what is referred to as the degree of uncertainty. With this number we can then specify our degree of diversity.
where H' = Information content of sample, Index of species diversity or Degree of Uncertainty, s = Number of species, pi = proportion of total sample belonging to ith species.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
You have a neuron with a resting potential of -55 mV, EK of -70 mV, and ENa of 50 mV. You decide to voltage clamp the neuron. Now, draw the membrane current over time. What will th
why should shivering contribute to heat gain in the body?
Objectives of Diabetes Counselling 1. Facilitating decision to start treatment and change life style 2. Providing psychological, social and emotional support for a.
Degrade a monoglyceride that has an 18-carbon fatty acid attached to it by Ester bonds. You will have to degrade the glycerol component followed by the fatty acid in presence of O2
Q. List the goals of management of Type 1 Diabetes Mellitus? Goals of management of Type 1 Diabetes Mellitus: a) to keep blood sugar level as close to normal as possible.
What are the types of digestion and of digestive system of platyhelminthes? Flatworms have incomplete digestive systems and they show intracellular and extracellular complement
Q. What is ST segment depression at rest? ST- segment depression has become severe, that is, 3 to 4mm or more in vigorous asymptomatic subjects. If the patient is known to have
Giemsa stain is a basic stain, thus the major chromagen is positively charged (cation). Why does this stain have an affinity for the bacteria cell wall, and for certain cellular co
How Athletes benefit from consuming high carbohydrate foods? Athletes benefit from consuming high carbohydrate foods immediately after ending repeated intervals of intense exer
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd