Explain risk assessment, Biology

Assignment Help:

Explain Risk Assessment

Risk Assessment  :  The scientific evaluation  of  known  or  potential adverse  health effects  resulting  from  human exposure to food borne hazards.  The process having  of the  following steps: 

(i)  hazard identification

(ii)  hazard  characterization

(iii) exposure assessment, and

(iv) risk characterization.

The definition contains quantitative risk assessment, which emphasizes  reliance  on numerical expressions of risk and also qualitative expression of risk, as well as, an indication of the attendant  uncertainties.

 

 


Related Discussions:- Explain risk assessment

How can bacteria produce human insulin, Q. How can bacteria produce human i...

Q. How can bacteria produce human insulin on an industrial scale? What are the other forms of insulin made available by the pharmaceutical industry? Bacteria don't naturally sy

Define the role of vitamin d in the immune system, Define the Role of Vitam...

Define the Role of Vitamin D in the immune system? Immune responses that are, mediated by T-cells can be inhibited by tile large doses of calcitriol i.e. 1, 25 dihydroxycholec

Parasympathetic discharge to the heart leads to, An enhance in parasympathe...

An enhance in parasympathetic discharge to the heart leads to A. An enhance in the conductance of F-channels in SA node cells. B. An enhance in the conductance of potassium

Determine the effect of iodine deficiency, Determine the Effect of Iodine D...

Determine the Effect of Iodine Deficiency? Iodine deficiency affects all populations at all stages of life, from the intrauterine stage to old age. However, pregnant women, lac

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Conditioned reflex , CONDITIONE D REFLEX - Response which is achiev...

CONDITIONE D REFLEX - Response which is achieved by training is conditioned reflex. I. P. Pavlov in 1920 displayed it by experimenting on dog. These are voluntary in

Explain the relative nucleotide content of each sample, Can you help explai...

Can you help explain this question in fairly simple terminology? A certain sample of DNA has a Tm of 65oC, while another has a Tm of 58oC. What can you tell about the relative n

Chemical weathering-formation of soil, Chemical Weathering The rocks wh...

Chemical Weathering The rocks while getting disintegrated may also undergo chemical change. Water is an important agent in bringing about chemical changes due to dissolution or

How many progeny flies have vestigial wings, In the fruit fly Drosophila, a...

In the fruit fly Drosophila, a rudimentary wing called "vestigial" and dark body color called "ebony" are inherited at independent loci and are recessive to their dominant wild-typ

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd