Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Risk Assessment
Risk Assessment : The scientific evaluation of known or potential adverse health effects resulting from human exposure to food borne hazards. The process having of the following steps:
(i) hazard identification
(ii) hazard characterization
(iii) exposure assessment, and
(iv) risk characterization.
The definition contains quantitative risk assessment, which emphasizes reliance on numerical expressions of risk and also qualitative expression of risk, as well as, an indication of the attendant uncertainties.
Q. How can bacteria produce human insulin on an industrial scale? What are the other forms of insulin made available by the pharmaceutical industry? Bacteria don't naturally sy
Define the Role of Vitamin D in the immune system? Immune responses that are, mediated by T-cells can be inhibited by tile large doses of calcitriol i.e. 1, 25 dihydroxycholec
An enhance in parasympathetic discharge to the heart leads to A. An enhance in the conductance of F-channels in SA node cells. B. An enhance in the conductance of potassium
Determine the Effect of Iodine Deficiency? Iodine deficiency affects all populations at all stages of life, from the intrauterine stage to old age. However, pregnant women, lac
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
CONDITIONE D REFLEX - Response which is achieved by training is conditioned reflex. I. P. Pavlov in 1920 displayed it by experimenting on dog. These are voluntary in
How it respire
Can you help explain this question in fairly simple terminology? A certain sample of DNA has a Tm of 65oC, while another has a Tm of 58oC. What can you tell about the relative n
Chemical Weathering The rocks while getting disintegrated may also undergo chemical change. Water is an important agent in bringing about chemical changes due to dissolution or
In the fruit fly Drosophila, a rudimentary wing called "vestigial" and dark body color called "ebony" are inherited at independent loci and are recessive to their dominant wild-typ
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd