Explain rickets, Biology

Assignment Help:

Explain Rickets

Rickets:- A condition in children due to vitamin D deficiency.

 


Related Discussions:- Explain rickets

Natality rate - natality, Natality Rate - Natality Natality rate or bi...

Natality Rate - Natality Natality rate or birth rate is determined by dividing the number of individuals born by unit time and is expressed as follows: Natality rate =  ΔNn

How do the repairing enzymes of the genetic system act, How do the repairin...

How do the repairing enzymes of the genetic system act? There are enzymes inside the cells that detect errors or alterations in DNA molecules and begin a repair of those errors

Topology and cell organ shapes, Topology and Cell Organ Shapes Topolog...

Topology and Cell Organ Shapes Topology is an abstract mathematical exercise that deals with the possible shapes and surfaces of an endlessly/infinitely elastic body. Most cel

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain gastrointestinal, Gastrointestinal Antibiotic prophylaxis is re...

Gastrointestinal Antibiotic prophylaxis is recommended for esophageal surgery in the presence of obstruction, which increases the risk of infection. After gas troduodenal surge

Cephalopods - feeding and digestion in molluscs, Cephalopods - Feeding and ...

Cephalopods - Feeding and Digestion in Molluscs Cephalopods are carnivorous. Tentacles or arms are food capturing organs. The number of tentacles changes in different cephalop

Vascular lesions caused by leeches upon the blood vessels, Q. The vascular ...

Q. The vascular lesions caused by leeches upon the blood vessels of their host cause blood naturally to coagulate. How does the leech solve this problem since it could be expected

What is immune memory, How can an organism that once underwent contact with...

How can an organism that once underwent contact with an antigen be immunized against future infections by the same agent? This phenomenon is known as immune memory . When an a

Evaluating the wound assessment , I will send any further instructions to y...

I will send any further instructions to you. The ist part of the assessment (1-7) that evaluates the chart i have done but it needs to be looked at to see if content okay & gram

Which structures of the body have more bones, Q. Which structures of the bo...

Q. Which structures of the body have more bones for their size than any other part of the body? Hand and wrist have more bones in them for their size than any other part of bod

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd