Explain repressors , Biology

Assignment Help:

Gene repressor proteins which inhibit the transcription of particular genes in eukaryotes also exist. They may act by binding either to control parts within the promoter region near the gene or at sites located a long distance away from the gene, called as silencers.  The repressor protein should inhibit transcription directly. One instance is the mammalian   thyroid   hormone   receptor   that,   in the absence   of   thyroid   hormone   represses   transcription   of   the   goal   genes. Furthermore, other repressors inhibit transcription by blocking activation.  This can be get  in one of several  ways:  by blocking  the DNA  binding  site for an activator  protein, through binding to and masking  the activation  domain of the activator  factor,  or  by  forming  a  non-DNA  binding  complex  with  the  activator protein. Several instance of every mode of action are known.

 


Related Discussions:- Explain repressors

Cell biology, Explain the functis of the main organelles in plant and anima...

Explain the functis of the main organelles in plant and animal cell as seen under the lightmicroscope

Korarchaeotes, what is the effect that korarchaeotes have on humans?

what is the effect that korarchaeotes have on humans?

What do you mean by handrail support, Many patients who are weak, fearful o...

Many patients who are weak, fearful or shot of breath find it essential to hold tightly to the handrail while walking. If accurate aerobic information is to be obtained handrail su

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define significance of plants and animals on human life, Define Significanc...

Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a

Male reproductive disorders, MALE REPRODUCTIVE DISORDERS Generally, ab...

MALE REPRODUCTIVE DISORDERS Generally, about 5-10% of cattle bulls reaching sexual maturity would be suffering from poor reproductive efficiency or sterility. Crossbreeding ha

Imagine an animal that hast he system similar to abo blood, Imagine an anim...

Imagine an animal that has a system similar to ABO blood types in humans. The ABO part is the same. In addition, they have a second independent gene that creates a mimic A protein,

Structure of water, STRUCTURE OF WATER It may interest you to know that w...

STRUCTURE OF WATER It may interest you to know that water is a universal solvent and is a major constituent of all living organisms. Earth is the only planet where water exists i

Explain about the biofertilizers, Explain about the Biofertilizers Biof...

Explain about the Biofertilizers Biofertilizers, are the cultures of microorganisms used for inoculating seed or soil or both under ideal conditions to increase the availabilit

Genetic, what are the limitation of mendelian experiment

what are the limitation of mendelian experiment

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd