Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Gene repressor proteins which inhibit the transcription of particular genes in eukaryotes also exist. They may act by binding either to control parts within the promoter region near the gene or at sites located a long distance away from the gene, called as silencers. The repressor protein should inhibit transcription directly. One instance is the mammalian thyroid hormone receptor that, in the absence of thyroid hormone represses transcription of the goal genes. Furthermore, other repressors inhibit transcription by blocking activation. This can be get in one of several ways: by blocking the DNA binding site for an activator protein, through binding to and masking the activation domain of the activator factor, or by forming a non-DNA binding complex with the activator protein. Several instance of every mode of action are known.
Explain the functis of the main organelles in plant and animal cell as seen under the lightmicroscope
what is the effect that korarchaeotes have on humans?
Many patients who are weak, fearful or shot of breath find it essential to hold tightly to the handrail while walking. If accurate aerobic information is to be obtained handrail su
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a
MALE REPRODUCTIVE DISORDERS Generally, about 5-10% of cattle bulls reaching sexual maturity would be suffering from poor reproductive efficiency or sterility. Crossbreeding ha
Imagine an animal that has a system similar to ABO blood types in humans. The ABO part is the same. In addition, they have a second independent gene that creates a mimic A protein,
STRUCTURE OF WATER It may interest you to know that water is a universal solvent and is a major constituent of all living organisms. Earth is the only planet where water exists i
Explain about the Biofertilizers Biofertilizers, are the cultures of microorganisms used for inoculating seed or soil or both under ideal conditions to increase the availabilit
what are the limitation of mendelian experiment
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd