Explain quantitative methods - therapeutic diets, Biology

Assignment Help:

Quantitative Methods - Therapeutic diets

Quantitative Methods: These are often essential for constructing  Lherapeutic diets.  The  two ways by which  this could be done are as follows:

i)  Using  an  exchange system which delivers  a  fixed  amount  of  nutrient per food  portion.  An  example  of  this  is  the  carbohydrate  exchange system  used  in  planning diets  for  insulin  dependent diabetics.  The desired level of  intake  is  specified and  the diet is  constructed  from an exchange list.

ii)  Quantifying the portion size of foods and the  frequency  of  their consumption. This diet is constructed from normal sized portions of foods but those foods which have  the highest content of  a particular nutrient per  portion are excluded from the diet. We learnt about this aspect earlier also, where we got to know about fat, Na and K restricted diets. We also had a look at the permitted  and excluded  food  items  based  on  their  nutrient  content.

 


Related Discussions:- Explain quantitative methods - therapeutic diets

Protein percentage in lowry method, How to calculate protein percentage in ...

How to calculate protein percentage in Lowry method? Ans) By verification of optical density by coloimetric method

Do plants placed under an environment drier than the habitat, Do plants pla...

Do plants placed under an environment drier than the habitat where they are used to living have a reduction or an increase in the time during which their stomata remain open? I

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

State the copious sterile saline irrigation, Using copious sterile saline i...

Using copious sterile saline irrigation This can be delivered from a sterile infusion bag in a pressure cuff or a peristaltic pump. The drills can be adequately cooled by spray

Integumentary system - glands, Glands - 1 .      SEBACEOUS GLAND - ...

Glands - 1 .      SEBACEOUS GLAND - Absent in palm and sole. Holocrine in nature. Branched, alveoli are present, sac like in appearance. Generally attached to fo

Zoonoses disease-yabapox, Yabapox Yabapox is a disease affecting mangabeys...

Yabapox Yabapox is a disease affecting mangabeys, rhesus, cynos, vervets, stumptails, and patas monkeys. It is caused by the Yaba-like disease virus (YLDV) and Yaba monkey tumor v

Explain three main steps for a good study of genetic tree, What are the thr...

What are the three main steps for a good study of a genetic family tree? Step 1: to determine whether the studied phenotypical form has a dominant or recessive pattern. Step

What are the properties of aqueous solutions, Which of the following is TRU...

Which of the following is TRUE about the properties of aqueous solutions? Select one: a. A pH change from 5.0 to 6.0 reflects an increase in the hydroxide ion concentration (

What are the main divisions and representing species, What are the main div...

What are the main divisions and representing species of the gymnosperms? This group of plants can be divided into conifers (pine, sequoia, cypress), that have flowers known as

Importance of research in nursing, Importance of Research in Nursing: ...

Importance of Research in Nursing: It is  the responsibility of the nursing profession  to discover, verify, structure and restructure the professional knowledge through  syst

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd