Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Quantitative Methods - Therapeutic diets
Quantitative Methods: These are often essential for constructing Lherapeutic diets. The two ways by which this could be done are as follows:
i) Using an exchange system which delivers a fixed amount of nutrient per food portion. An example of this is the carbohydrate exchange system used in planning diets for insulin dependent diabetics. The desired level of intake is specified and the diet is constructed from an exchange list.
ii) Quantifying the portion size of foods and the frequency of their consumption. This diet is constructed from normal sized portions of foods but those foods which have the highest content of a particular nutrient per portion are excluded from the diet. We learnt about this aspect earlier also, where we got to know about fat, Na and K restricted diets. We also had a look at the permitted and excluded food items based on their nutrient content.
How to calculate protein percentage in Lowry method? Ans) By verification of optical density by coloimetric method
Do plants placed under an environment drier than the habitat where they are used to living have a reduction or an increase in the time during which their stomata remain open? I
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Using copious sterile saline irrigation This can be delivered from a sterile infusion bag in a pressure cuff or a peristaltic pump. The drills can be adequately cooled by spray
Glands - 1 . SEBACEOUS GLAND - Absent in palm and sole. Holocrine in nature. Branched, alveoli are present, sac like in appearance. Generally attached to fo
Yabapox Yabapox is a disease affecting mangabeys, rhesus, cynos, vervets, stumptails, and patas monkeys. It is caused by the Yaba-like disease virus (YLDV) and Yaba monkey tumor v
What are the three main steps for a good study of a genetic family tree? Step 1: to determine whether the studied phenotypical form has a dominant or recessive pattern. Step
Which of the following is TRUE about the properties of aqueous solutions? Select one: a. A pH change from 5.0 to 6.0 reflects an increase in the hydroxide ion concentration (
What are the main divisions and representing species of the gymnosperms? This group of plants can be divided into conifers (pine, sequoia, cypress), that have flowers known as
Importance of Research in Nursing: It is the responsibility of the nursing profession to discover, verify, structure and restructure the professional knowledge through syst
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd