Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Pyridoxal phoshphate
Pyridoxal phosphate is derived from pyridoxine (vitamin B6) and is involved in amino acid metabolism. The other two compounds, pyridoxal and pyridoxamine, about which you learnt in the last unit, having the properties of vitamin B6 also occur as phosphate derivatives. Enzymes that are dependent on B6 phosphate coenzymes catalyze a variety of reactions such as transamination (transfer of amino group from an amino acid to a keto acid), decarboxylation (removal of carboxyl group) and racemization (transformation of one isomer to another.
Blunt or Non-penetrating Injury When body is struck by a blunt object such as steering wheel or blows to chest with blunt object. External injury may appear minor but the
drawandlabelthemajorendocrineglandsinthehumanbody
What are the hormones secreted by the adrenal medulla? What are their respective functions? The medullary portion of the adrenals secretes hormones of the catecholamine group:
Q. Can you explaon about Aortography? Visualization of the aorta and its branches is possible by several modalities today. Apart from angiography, aorta can also be visualized
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How is the striped pattern of the striated muscle cells formed? The functional units of the muscle fibers are the sarcomeres. Within the sarcomeres blocks of myosin and actin
What are some mechanisms by which pathogenic bacteria cause diseases? Why is this knowledge important? Pathogenic bacteria have characteristics called as virulence factors that
EGG S OF HEN It is a meiolecithal egg which is oval. The animal pole is found in the form of a small germinal disc. The vegital pole has two types of yolk viz. White yol
Patient is a 7-year-old girl who was brought to her physician by her mother with complaints of general fatigue, anorexia, and unexplained bruises and "rash" for the past 2 weeks. C
What is the difference between homologous and heterologous immunoglobulins? Homologous immunoglobulin is the human (from the similar species) immunoglobulin. In case of inocula
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd