Explain prosthetic device infections, Biology

Assignment Help:

Explain Prosthetic device infections

Some infectious disease specialists recommend antimicrobial prophylaxis before process in patients with vascular grafts or orthopedic prostheses.

Guidelines have been suggested for antimicrobial prophylaxis of patients with total joint arthroplasty undergoing dental or genitourinary procedures. No data exist from controlled human trials to support or refute these practices. For patients undergoing other invasive procedures that may result in transient bacteremia, using an approach same to that for endocarditis prevention seems reasonable.

 


Related Discussions:- Explain prosthetic device infections

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Parasitology, how trematodes/nematodes adapt to their parasitic mode of fee...

how trematodes/nematodes adapt to their parasitic mode of feeding

Metameric segment - segmentation, Metameric segment - Segmentation On ...

Metameric segment - Segmentation On the other hand true metameric segment as best observed in annelids has separate schizocoelic body cavity of mesodermal origin in each segme

Which are the growth tissues of plants, Which are the growth tissues of pla...

Which are the growth tissues of plants? How do they categorize and where can they be found? The growth tissues of the plants are the meristems. Meristems are the tissues that m

What is ascending aortic aneurysm, What is Ascending Aortic Aneurysm ? ...

What is Ascending Aortic Aneurysm ? Ascending Aortic Aneurysm :  In aneurysms confined to ascending aorta well below the innominate artery origin, the technique used is

Cytosketal mechanism, Cytosketal Mechanism There are two co-ordinate ...

Cytosketal Mechanism There are two co-ordinate processes in the cleavage (or cell division) that is displayed in Figure. Karyokinesis The mitotic division of nucleus

Define the roller drying (drum drying) method, Define the Roller Drying (Dr...

Define the Roller Drying (Drum drying) Method? One of the important techniques for drying liquid food products is the roller drier. Like spray drying, roller drying can only be

Determine the effect of drug on the blood pressure of rats, A scientist wan...

A scientist wanted to study the effect of a drug on the blood pressure of rats. She set up an experiment in which the experimental group consisted of rats that were injected with a

Can you explain bayesian theorem, Q. Can you explain Bayesian Theorem? ...

Q. Can you explain Bayesian Theorem? Bayesian Theorem: The predictive value of a test is related to the incidence of disease in the population. A history of typical angin

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd