Explain prosthetic device infections, Biology

Assignment Help:

Explain Prosthetic device infections

Some infectious disease specialists recommend antimicrobial prophylaxis before process in patients with vascular grafts or orthopedic prostheses.

Guidelines have been suggested for antimicrobial prophylaxis of patients with total joint arthroplasty undergoing dental or genitourinary procedures. No data exist from controlled human trials to support or refute these practices. For patients undergoing other invasive procedures that may result in transient bacteremia, using an approach same to that for endocarditis prevention seems reasonable.

 


Related Discussions:- Explain prosthetic device infections

Explain the role of lipoprotein, Explain the Role of Lipoprotein ? As d...

Explain the Role of Lipoprotein ? As discussed in the previous section, serum concentrations of Lp(a) are elevated in South Asians irrespective of their migrant status. Several

Carbomedics valve-types of valves, Carbomedics Valve :  Almost simila...

Carbomedics Valve :  Almost similar to StJude Medical valve, his is a low profile bileaflet valve made of pyrolitic carbon. On echo cardiography four small jets of regurg

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is dry mass, What is dry mass? When biomasses are compared often t...

What is dry mass? When biomasses are compared often the method of dry mass is used. The dry mass is the total mass less the water mass of an individual. The total mass is also

What ions must a plant obtain from the soil, What ions must a plant obtain ...

What ions must a plant obtain from the soil in order to make (a) ATP, (b) chlorophyll?   (a) To create ATP (adenosine triphosphate) a plant requires a supply of phosphate io

What is the difference between facilitated and diffusion, Q. What is the di...

Q. What is the difference between facilitated and simple diffusion? Facilitated by which kind of molecule does the term "facilitated" mean? Simple diffusion is the direct passa

If the protein binds to any other proteins, You are studying a gene, and it...

You are studying a gene, and its effects on skin cells. You want to find out A) If the protein made encoded by this gene binds to DNA in a particular place B) if the protein binds

What is an antigen, Q. What is an antigen? Antigen is any substance, in...

Q. What is an antigen? Antigen is any substance, infectious or particle agent recognized as foreign to the body. The contact of the antigen with the body promotes a defense rea

Biology, What are the differences b/w bone and cartiledge

What are the differences b/w bone and cartiledge

Etiology and clinical features - neurological disorder, Define Etiology and...

Define Etiology and Clinical Features that causes neurological disorder? The cause of this neurological disorder can be mechanical or paralytic. The mechanical cause is primari

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd