Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phylum platyhelminthes (13,000 species Flatworm)
The body is flattened. Gastrovascular cavity is branched, dense bodies with many cell layers, mouth but no anus. Hermaphrodite often with elaborate precautions for minimising self-fertilisation. Phylum contains many important parasites.
Three classes:
Turbellaria
Trematoda
Cestoda
Describe the IMPACT AND BURDEN OF HEART DISEASES ? No discussion on the epidemiology of heart diseases will be complete without a look at the tremendous burden put by different
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How different are hemoglobin and oxyhemoglobin? Where is it expected to find a higher concentration of oxyhemoglobin, in peripheral tissues or in the lungs? Oxygen-bou
Agro-industrial by-products (AIBP) refer to the by-products derived due to processing of the main crop products and allied industries. They are in comparison to crop residues, are
Systolic heart failure is a classic heart failure where the inotropic (contractile) state is impaired and the expulsion of blood is not adequate. So the main manifestations of syst
Explain the Evolution of the Vascular Plant Body? Vascular Plant anatomy reflects adaptation to life on land. In an aquatic environment, the photosynthetic surfaces are support
Define Polyacrylamide gel electrophoresis (PAGE)? Acrylamide gel has the advantage over starch in that it is easier to prepare and is more inert, the pore size can be varied in
What is HACCP? HACCP, as you may already know, is an acronym that stands for Hazard Analysis Critical Control Point, a systematic, science-based approach used in food
ORIGIN (1) From Pro plastid (2) Division (3) Endosymbiotic origin from a cyanobacterium
Q. Enumerate the advantages of implant supported prosthesis over a removable one Removable soft tissue-borne partial dentures have one of the lowest patient acceptance rates in
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd