Explain phylum ciliophora, Biology

Assignment Help:

Phylum Ciliophora

1) They have cilia at some stage in the life-cycle. The cilia are used for locomotion or creating a feeding current.

2) They feed heterotrophically usually by phagocytosis.

3) They have two nuclei, i) meganucleus and ii) micronucleus. The former concerned with vegetative functions of thc organisms and the latter with reproductive functions.

 

Some examples : Puramecium, Styloniclzia, Vorticella, Suctorians

 


Related Discussions:- Explain phylum ciliophora

Healthcare delivery - risk pooling, Normal 0 false false fa...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What is surgical therapy, Surgical Therapy The clinician may use a surg...

Surgical Therapy The clinician may use a surgical approach when non-surgical therapies are not indicated or are unsuccessful. The surgical techniques are modified from those

Oxygenator- equipment of cardio pulmonary bypass , Oxygenator :   They serv...

Oxygenator :   They serve the function of lungs during extra corporeal circulation (ECC) - Oxygenation, removal of carbon dioxide and transport of gaseous anaesthetic agents:*The o

Define pseudo-yeasts, Q. What are the Pseudo-yeasts? These are like tru...

Q. What are the Pseudo-yeasts? These are like true yeasts but do not form spores. All the members of this group are particularly unsuitable for fermentation purposes as they p

Taxonomy, what arachnid is beneficial

what arachnid is beneficial

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe ecological importance of fungi, Q. What is the ecological importan...

Q. What is the ecological importance of fungi? Fungi are decomposers and heterotrophs they break down dead beings and they actively participate in the recycling of organic mate

Explain change in body composition of infants, Explain Change in body Compo...

Explain Change in body Composition of infants? The weight gain comprise of growth in the muscle, organ tissue, adipose and skeletal structure. One compartment of body which reg

Explain about the alitame - artificial sweeteners, Explain about the Alitam...

Explain about the Alitame - artificial sweeteners? Alitame (L-α-aspartyl-N-(2, 2, 4, 4-tetramethyl-3-thietanyl)-D-alaninamide), as illustrated in figure, is a sweetener based o

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd