Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phylum Ciliophora
1) They have cilia at some stage in the life-cycle. The cilia are used for locomotion or creating a feeding current.
2) They feed heterotrophically usually by phagocytosis.
3) They have two nuclei, i) meganucleus and ii) micronucleus. The former concerned with vegetative functions of thc organisms and the latter with reproductive functions.
Some examples : Puramecium, Styloniclzia, Vorticella, Suctorians
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Surgical Therapy The clinician may use a surgical approach when non-surgical therapies are not indicated or are unsuccessful. The surgical techniques are modified from those
Oxygenator : They serve the function of lungs during extra corporeal circulation (ECC) - Oxygenation, removal of carbon dioxide and transport of gaseous anaesthetic agents:*The o
Q. What are the Pseudo-yeasts? These are like true yeasts but do not form spores. All the members of this group are particularly unsuitable for fermentation purposes as they p
introduction
what arachnid is beneficial
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the ecological importance of fungi? Fungi are decomposers and heterotrophs they break down dead beings and they actively participate in the recycling of organic mate
Explain Change in body Composition of infants? The weight gain comprise of growth in the muscle, organ tissue, adipose and skeletal structure. One compartment of body which reg
Explain about the Alitame - artificial sweeteners? Alitame (L-α-aspartyl-N-(2, 2, 4, 4-tetramethyl-3-thietanyl)-D-alaninamide), as illustrated in figure, is a sweetener based o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd