Explain phylum-bacteria, Biology

Assignment Help:

Phylum-Bacteria (Eubacteria)

Eubacteria,th e true bacteria, are extremely small and they exist in vast numbers virtually everywhere on earth. They range from the upper atmosphere to hot springs, polar ice caps, raw petmleum, the deepest reaches of the sea and animal guts. It is believed that their mass will out weight that of all plants and animals combined.

 


Related Discussions:- Explain phylum-bacteria

Which animals make cutaneous respiration, Q. Which animals make cutaneous r...

Q. Which animals make cutaneous respiration? Adult amphibians and Terrestrial annelids make cutaneous respiration in amphibians there is also pulmonary respiration, the thin sk

Define prevention in the prevalence of overweight or obesity, Define Preven...

Define Prevention in the prevalence of overweight or obesity? It is believed that the increase in prevalence of obesity worldwide is more due to the environment that has become

Is the bone marrow made of osseous tissue, Q. In which bones can bone marro...

Q. In which bones can bone marrow chiefly be found? Is the bone marrow made of osseous tissue? Bone marrow can mainly be found in the internal cavities of flat bones, like the

Diplotene and diakinesis, Diplotene: The paired chromosomes repel eac...

Diplotene: The paired chromosomes repel each other and begin to separate. Separation however, is not completed, because homologous chromosomes remain united by their point

Explain phenylephine and methoxamine in amyl nitrite, Explain Phenylephine ...

Explain Phenylephine and Methoxamine in amyl nitrite ? They have opposing effects to amyl nitrite as they increase the systemic BP. phenylephine due to its shorter duration of

Physical layout - neonatal care unit, PHYSICAL LAYOUT In this section ...

PHYSICAL LAYOUT In this section we shall focus on location floor plan, ventilation, lighting environmental temperature and humidity, acoustic characteristic, communication sy

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the uses of wpc, What are the uses of WPC?  Whey protein conce...

What are the uses of WPC?  Whey protein concentrates are used extensively in the manufacture of baked goods, where they enhance the effectiveness of shortening through better d

Define corneal xerosis - micronutrient deficiencies, Define Corneal Xerosis...

Define Corneal Xerosis - Micronutrient Deficiencies? This is a sign of severe vitamin 'A' deficiency, in which the cornea loses its normal smooth and glistening appearance and

What are cytokinins, What are cytokinins? Where are they made? Cytokini...

What are cytokinins? Where are they made? Cytokinins are phytohormones active in the promotion of cellular division; they slow down the aging of tissues and act together with a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd