Explain phylum ascomycetes, Biology

Assignment Help:

Phylum Ascomycetes

1) Sexual reproduction is by conjugation and is followed by the formation of ascospores inside a sac called ascus.

2) The asci may be grouped together to form a cup-shaped structure known as Peritheciurn.

Some examples : Sordaria, Neurospora, Penicillium.

 


Related Discussions:- Explain phylum ascomycetes

Types of aortic stenosis-aortic stenosis-valve disease, Types of Aortic Ste...

Types of Aortic Stenosis:  Obstruction to left ventricular outflow is commonly at the valvar level. Less commonly it is at the sub valvar or supra valvar level. Sub valvar ob

Carbon cycle, state 3 ways human activities add carbon to the atmosphere

state 3 ways human activities add carbon to the atmosphere

Pericardium, The heart is enclosed in a membranous sac called the pericardi...

The heart is enclosed in a membranous sac called the pericardium. It has two layers- the fibrous pericardium which is the outer layer and the serous pericardium that lies inside th

Are nematodes exclusively parasites, Are nematodes exclusively parasites? ...

Are nematodes exclusively parasites? There are parasitic roundworms, containing parasites of plants, but there are also free-living nematodes.

Explain reality theory, Reality Theory Developed in  the 1960s by  Will...

Reality Theory Developed in  the 1960s by  Willian glasser,  a  psychiatrist,  reality  therapists  view human nature in terms of behaviour. They believe that human behaviour i

What is lysosomes, What is Lysosomes? Lysosomes :  Animal and fungal ...

What is Lysosomes? Lysosomes :  Animal and fungal cells contain membrane-bound organelles called lysosomes, which are filled with digestive enzymes. These digestive enzyme

Supply of animals in lab, Supply of Animals: Lab animals must be obtained ...

Supply of Animals: Lab animals must be obtained from accredited dealers and by accredited dealers, we mean suppliers in the business of supplying animals for lab use, and not from

Define isolated soybean proteins in infant formulas, Define isolated soybea...

Define isolated soybean proteins in Infant formulas? Infant formulas, where milk solids have been replaced by soy products, are well established commercial products. ISP is the

Explain types of dietary adaptations for trerapieutic needs, Types of dieta...

Types of dietary adaptations for trerapieutic needs Normal nutrition is the foundation upon which therapeutic modifications are based. We  have already discussed  in  previous

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd