Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phylum Ascomycetes
1) Sexual reproduction is by conjugation and is followed by the formation of ascospores inside a sac called ascus.
2) The asci may be grouped together to form a cup-shaped structure known as Peritheciurn.
Some examples : Sordaria, Neurospora, Penicillium.
Types of Aortic Stenosis: Obstruction to left ventricular outflow is commonly at the valvar level. Less commonly it is at the sub valvar or supra valvar level. Sub valvar ob
state 3 ways human activities add carbon to the atmosphere
The heart is enclosed in a membranous sac called the pericardium. It has two layers- the fibrous pericardium which is the outer layer and the serous pericardium that lies inside th
Are nematodes exclusively parasites? There are parasitic roundworms, containing parasites of plants, but there are also free-living nematodes.
Reality Theory Developed in the 1960s by Willian glasser, a psychiatrist, reality therapists view human nature in terms of behaviour. They believe that human behaviour i
What is Lysosomes? Lysosomes : Animal and fungal cells contain membrane-bound organelles called lysosomes, which are filled with digestive enzymes. These digestive enzyme
Supply of Animals: Lab animals must be obtained from accredited dealers and by accredited dealers, we mean suppliers in the business of supplying animals for lab use, and not from
Define isolated soybean proteins in Infant formulas? Infant formulas, where milk solids have been replaced by soy products, are well established commercial products. ISP is the
Types of dietary adaptations for trerapieutic needs Normal nutrition is the foundation upon which therapeutic modifications are based. We have already discussed in previous
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd