Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phylum Arthropoda : (8,00,000 to 10,00,000 species)
They are known as 'jointed footed' animals. The appendages are paired, and jointed with chitinous exoskeleton, varied and wide segmentation, wide distribution.
Q. What are the two divisions of meiosis and what are the major events that occur in those divisions? Meiosis is divided into first meiotic division, or meiosis I, and second m
How is digestion performed in protozoans? Digestion in protozoans is intracellular digestion: organic material is internalized and degraded inside the cell. Protozoans get
Dormant Vegetative Structures You have learnt that light a period of chilling or application of gibberellin often breaks seed dormancy and stimulates seed germination. Vegetat
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
types of parthenocarpy
Diagnosis Chest X-ray, Sputum Cytology Test Fibro Optic Bronchoscopy and Biopsy In later stage of disease - weight loss, Debility indicating metastasis Staging of
Q. What is the vector of malaria? How different is its behavior from the behavior of the vector of dengue fever? The vector of malaria is the mosquito of the genus Anopheles, a
Detritus Food Chains Detritus food chains begin with dead organic matter which is an important source of energy. A large amount of organic matter is contributed by the death o
Q. What is the neurotransmitter of the neuromuscular junction? How does the nervous system trigger muscle contraction? The nervous cells that trigger the muscle contraction are
#in which part of alimentary canal oblique muscle found?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd