Explain phylum arthropoda, Biology

Assignment Help:

Phylum Arthropoda : (8,00,000 to 10,00,000 species)

They are known as 'jointed footed' animals. The appendages are paired, and jointed with chitinous exoskeleton, varied and wide segmentation, wide distribution.

 


Related Discussions:- Explain phylum arthropoda

Explain two divisions of meiosis, Q. What are the two divisions of meiosis ...

Q. What are the two divisions of meiosis and what are the major events that occur in those divisions? Meiosis is divided into first meiotic division, or meiosis I, and second m

How is digestion performed in protozoans, How is digestion performed in pro...

How is digestion performed in protozoans? Digestion in protozoans is intracellular digestion: organic material is internalized and degraded inside the cell. Protozoans get

Dormant vegetative structures, Dormant Vegetative Structures You have ...

Dormant Vegetative Structures You have learnt that light a period of chilling or application of gibberellin often breaks seed dormancy and stimulates seed germination. Vegetat

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Diagnosis and management of cancer lung, Diagnosis Chest X-ray, Sp...

Diagnosis Chest X-ray, Sputum Cytology Test  Fibro Optic Bronchoscopy and Biopsy  In later stage of disease - weight loss, Debility indicating metastasis Staging of

What is the vector of malaria, Q. What is the vector of malaria? How differ...

Q. What is the vector of malaria? How different is its behavior from the behavior of the vector of dengue fever? The vector of malaria is the mosquito of the genus Anopheles, a

Detritus food chains, Detritus Food Chains Detritus food chains begin ...

Detritus Food Chains Detritus food chains begin with dead organic matter which is an important source of energy. A large amount of organic matter is contributed by the death o

What is the neurotransmitter of the neuromuscular junction, Q. What is the ...

Q. What is the neurotransmitter of the neuromuscular junction? How does the nervous system trigger muscle contraction? The nervous cells that trigger the muscle contraction are

#ALIMENTARY SYASTEM.., #in which part of alimentary canal oblique muscle fo...

#in which part of alimentary canal oblique muscle found?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd