Explain phylogenetic or cladistic classification, Biology

Assignment Help:

Phylogenetic or Cladistic Classification

Phylogeny plays a great role in classification. It is the  appropriate theoretical background for taxonomy and is quite essential in explaining all the associations involved in classification. Some people believe phylogenetic and evolutionary classification are similar to each other since they both are based on the features derived from a common ancestor while some other consider as different approaches. Cladistic classification is exclusively based on phylogenetic branching. Cladistic phylogeny, in opposition to numerical phenetics, includes an attempt to map the sequence of phyletic branching through a determination of characters that are shared primitive (symplesiomorphic) and shared derived (synapomorphic).But, to date there is no true phylogenetic classification for any group of animals except (to some extent) that of horses. This is due to incomplete fossil record and also becausethe comparative data collected through other approaches fail to possibly give a clear picture by itself. Thus, cladistic taxonomic system attempts to communicate only genealogy. There is no attempt to express the degree of overall similarity of the organisms in such classification systems.

 


Related Discussions:- Explain phylogenetic or cladistic classification

Urine analysis, Urine analysis - microhematuria with or without proteinuria...

Urine analysis - microhematuria with or without proteinuria may be seen. ECG - All patients with suspected IE should have baseline and follow up ECG which may reveal conduction

Phase (different interference) contrast microscopy, Phase (different interf...

Phase (different interference) Contrast microscopy: Living cells are mostly   transparent. For viewing under ordinary light microscope, therefore, live cells must be stained wi

Biochemistry, Water is most dense and thus heavier at 4 degreese celceus. A...

Water is most dense and thus heavier at 4 degreese celceus. At 0 degreese celceus ice forms and can float on liquid water. Assuming that ice were most dense at 0 degreese celceus,

In what ways is genomic imprinting similar to x-inactivation, Based on the ...

Based on the simplified two-gene model for eye colour, explain using genotypes how two blue-eyed parents could produce a brown-eyed child. In what ways is genomic imprinting sim

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the term light reflex - neuronal pathways, Explain the term Light r...

Explain the term Light reflex - Neuronal pathways The neuronal pathway for light reflex can be afferent and efferent. In the afferent pathway, the pupillary fibres begin in the

Define modes or techniques for chromatographic separation, Define Modes or ...

Define Modes or Techniques for Chromatographic Separation In practice, chromatographic separation may take one of these modes or techniques:   Paper chromatography (in w

Reproduction, what is the difference between anaisogyami & oogyami?

what is the difference between anaisogyami & oogyami?

What are the general necessities for surgery, General necessities for surge...

General necessities for surgery The actual surgical technique of dental implant placement, it would be appropriate to recapitulate the basic principles of surgery. The two prin

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd