Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Pasteurization
The act or process of heating a beverage or other food, to a specific temperature for a specific period of time in order to kill microorganisms that could cause disease, spoilage, or undesired fermentation.
Define the role of Fluorine in Human Body? Fluorine is potentially a toxic element. Its essentiality for humans is not established although the role of fluoride in providing pr
On the overall process of cell-to-cell communication within the nervous system, what role does the Ca2+ play in the synapse? A) contributes in the biosynthesis of acetylcholine B)
Q. Why are transgenics considered a threat to the environmental safety? The Transgenics can be dangerous to the whole biosphere since the transfer of genes between species may
State the term - Early therapeutic Intervention Since outcome may be ameliorated by well timed and appropriate treatment, the prevailing belief is that dysfunction should be id
Illustrate about Nervous System Functional unit of nervous system is neuron. Neuron is nerve cell. Information passes through neurons by nerve impulses. Nervous system corre
Class of Mollusca - Monoplacophora Bilaterally symmetrical, with broad flat foot and single shell, mantle cavity has five to six pairs of gills; six pairs of nephridia of whi
Define functions of magnesium - Macro minerals? Like Ca, Mg too has a role in bone formation. Soft tissue magnesium functions as a cofactor of many enzymes involved in energy m
Illustrate about the metabolic waste products in the cornea? Metabolic Waste Products During the metabolism various waste products including lactic acid, protein an
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The Polymerase Chain Reaction Kary Mullis established the technique of the polymerase chain reaction (PCR) in the year of 1983. He won a Nobel Prize for the procedure in the ye
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd