Explain pasteurization, Biology

Assignment Help:

Explain Pasteurization

The act or process of heating a beverage or other food, to a specific temperature for a specific period of time in order to kill microorganisms that could cause disease, spoilage, or undesired fermentation.

 


Related Discussions:- Explain pasteurization

Nucleic acid amplification, Ask Prepare a 2-4 page summary of nucleic aci...

Ask Prepare a 2-4 page summary of nucleic acid amplification techniques that are being explored in the development of nucleic assays for clinical use. Research and identify a mo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the glycogen receptors in the plasma membranes, Which of the foll...

Which of the following serves as an effector, or as part of an effector, that functions in a negative feedback system? A. Glycogen Receptors in the plasma membranes of liver ce

What is the process of breathing, What is the process of Breathing? Oxy...

What is the process of Breathing? Oxygen is supplied to the blood, and carbon dioxide is removed from the blood by the process known as breathing. Air is moved into an exchan

Why pluto is no longer considered a planet, Describe how the International ...

Describe how the International Astronomical Union defines a planet. Also include why Pluto is no longer considered a planet.

Describe amoebae - paramecia and trichomonas, Q How do amoebae, paramecia a...

Q How do amoebae, paramecia and trichomonas respectively move? Amoebae move by amoeboid movements small invaginations and projections of their plasma membrane (pseudopods) that

Determine the greater palatine nerve and vessel, Greater Palatine nerve and...

Greater Palatine nerve and vessel  The greater palatine nerve runs forward in a groove on the inferior surface of the hard palate to communicate with nasopalatine nerve in inci

Explain the oligosaccharides (dp: 3-9) - carbohydrates, Explain the Oligosa...

Explain the Oligosaccharides (DP: 3-9) - carbohydrates? Oligosaccharides consists of short chains of monosaccharide units joined by covalent bonds. The glycosidic bond may be α

Explain injection rate and volume, Q. Explain Injection Rate and Volume? ...

Q. Explain Injection Rate and Volume? This is best achieved by injecting directly into the ventricular chamber. Midcavitary position of the catheter ensures that there is no ve

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd