Explain particle movement , Biology

Assignment Help:

Explain Particle Movement ?

Particle Movement : Particles are moved down a concentration gradient by the process of diffusion. Osmosis is simply the diffusion of water across a semipermeable membrane. We show four examples of osmosis - two with a red blood cell, and two with a plant cell. Diffusion and osmosis are vital for exchanging fluids, gases, and other substances in cells.

Related Discussions:- Explain particle movement

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define repletion studies for studying nutrient requirement, Explain the Dep...

Explain the Depletion and Repletion Studies for studying nutrient requirement? This is an experimental procedure in which volunteer subjects are kept on a diet devoid of a part

Which chemical elements are involved in most of matter, Q. Which chemical e...

Q. Which chemical elements are involved to form most of living biological matter? Ans The chemical elements that form most of the molecules of living beings are carbon (C)

Reproduction, what is mieosis

what is mieosis

Determine the adaptation to terrestrial life, Why can the amnion also be co...

Why can the amnion also be considered an adaptation to terrestrial life? The amnion is also an adaptation to dry land since one of its functions is to prevent desiccation of th

Genetic diversity of population, Genetic Diversity of Population The b...

Genetic Diversity of Population The biological diversity of animals, plants, and microorganisms is of fundamental importance to human survival. The term "gene resources" may b

Lungs, what is the lungs structure in relation to the excretory system?

what is the lungs structure in relation to the excretory system?

Ventilation of gills, Ventilation of Gills Various mechanical devices ...

Ventilation of Gills Various mechanical devices are used to increase the flow of water over the gill's surface. There can be two means of increasing the flow of water over the

Explain prophylaxis - fungal infection, Prophylaxis High-risk neutrope...

Prophylaxis High-risk neutropenic patients, such as those undergoing allogeneic and certain autologous stem cell transplants, and those with hematologic malignancy who are exp

Types of transport process in sieve tubes, Types of Transport Process in Si...

Types of Transport Process in Sieve Tubes The metabolites of all the mesophyll cells around the sieve elements join in a common pool to load via the surrounding transfer cells

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages