Explain objective anti-arrhythmic pacemaker defibrillators, Biology

Assignment Help:

Explain Objective Anti-arrhythmic pacemaker defibrillators?

After reading this unit, you should be able to:
1 describes the classification of ant arrhythmic drugs;
2 understand and describe the mechanism of action of different classes of antiarrhythmic drugs;
3 understand and describe the indications, mechanism faction and methods of implementation of cardiac pace maker; and
4 understand the usefulness of action of defibrillator.


Related Discussions:- Explain objective anti-arrhythmic pacemaker defibrillators

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Difference between smooth and rough endoplasmic reticulum, What is the diff...

What is the difference among smooth and rough endoplasmic reticulum?       Ans) The endoplasmic reticulum is a fine membranous structure contiguous to the nuclear membrane and p

Biology, how can i get an demo assignment to solve?

how can i get an demo assignment to solve?

Why is sub-culturing essential in plant tissue culture, Why is sub-culturin...

Why is sub-culturing essential in plant tissue culture? Explain the process of heterosis. How is it dissimilar from inbreeding depression? Where and how is urea produced in

Define water of oxidation or metabolic water, Define Water of oxidation or ...

Define Water of oxidation or metabolic water? Water that arises from oxidation of foods within the body, which is referred to as water of oxidation or metabolic water. Water wh

Biological diversity protection, Q. How can a great biological diversity pr...

Q. How can a great biological diversity protect an ecosystem from environmental damage? Why are less biodiverse ecosystems at risk of suffering deep biological harm if submitted to

Anatomy of the brain, In order to be able to study the neural basis of perc...

In order to be able to study the neural basis of perceptual and cognitive functions, it is necessary to have some knowledge of brain anatomy (i.e., what the names of different brai

Find out the degrees of freedom, -The expected phenotypic ratio of offsprin...

-The expected phenotypic ratio of offspring. -The expected genotypic ratio of offspring. -Calculate the expected values you would use on a chi-square test (use genotypic rati

Excretion, what is the excretory organ of agama lizard

what is the excretory organ of agama lizard

What is meant by post-translational modification, What is meant by "post-tr...

What is meant by "post-translational modification"? Give examples of post-translational modifications of the following amino acids: a. Serine b. Lysine C. Choose a third amino acid

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd