Explain nutrition assessment, Biology

Assignment Help:

Nutrition Assessment

The nutritional care process, you would realize, begins with nutritional assessment. Nutrition  assessment  is  the  evaluation  of  an individual's nutritional  status  and nutrient  requirements.  It  is a  systematic  process of  obtaining,  verifying, and interpreting  data  in  order  to  make decisions about the nature  and  cause  of nutrition-related problems. It is  an ongoing, dynamic process that  involves  not only initial data collection, but also  continual reassessment and analysis of patients/clients/ groups needs. The purpose of  nutrition assessment is to:

Obtain adequate information in order to identify nutrition-related problems,

Define accurately an individual's nutritional status,

Determine the level of nutritional support that individuals need, and

Monitor changes in the nutritional status and the effect of nutritional intervention.

 


Related Discussions:- Explain nutrition assessment

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Do all the eukaryotic cells, Q. Do all the eukaryotic cells have nucleus an...

Q. Do all the eukaryotic cells have nucleus and/or only one nucleus? There are eukaryotic cells devoid of a nucleus and others with more than one nucleus. Osteoclasts, the cell

What is the karyotype found in down syndrome, What is the karyotype found i...

What is the karyotype found in Down syndrome? Down syndrome is an aneuploidy, i.e., a numeric changing of chromosomes within the cells compared to the normal number of chromoso

Categorisation of neuropsychological assessment, Categorisation of Neuropsy...

Categorisation of Neuropsychological Assessment One can divide neuropsychological assessment into two areas: i) Comprehensive and ii) Specialised assessment. Comprehen

Procedure for nelson somogyi method for glucose estimation, Explain Procedu...

Explain Procedure for nelson somogyi method for glucose estimation? Carry out the procedure following the steps enumerated herewith: 1. Label a series of  Folins tubes as bl

What is centrioles in cell structure, What is Centrioles in cell structure?...

What is Centrioles in cell structure? Most cells of higher organisms contain pairs of cylindrical bodies called centrioles, which help to organize microtubules in cell division

Tertiary structure of protein, T ertiary Structure (3 o S tructure) ...

T ertiary Structure (3 o S tructure) Highly folded protein. Globular in structure. Tertiary structure is stabilised by five types of bonds : (i )      P

Show metabolic rate of aerobic organisms, Q. Why can be the consumption of ...

Q. Why can be the consumption of molecular oxygen indicates the metabolic rate of aerobic organisms? Molecular oxygen (O 2 ) consumption has direct relation to the cell metabol

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd