Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Alertness and sleep are dependent on the activity of the brain as a whole, although different levels of consciousness are determined primarily by areas of the brain stem. A key anatomical structure in the regulation of waking and sleeping, (and thus consciousness), is the reticular formation, located in the brain stem. It is a highly complex interlacing network of fiber bundles. Neuro chemically, there is a great diversity of neurotransmitters present: serotonin, mainly from the mid-line raphe nuclei; noradrenaline from the locus coeruleus; acetylcholine from pedunculopontine nuclei with also peptidergic and dopaminergic components.
The alterations in the activity of these neurotransmitters either triggers or accompany the onset of natural sleep and distinguish slow wave or non-REM from REM sleep thus providing one of the most compelling arguments in favour of chemical neurotransmission being specifically involved in mechanisms of conscious awareness.
Pharmacological manipulations of these neurotransmitters provide evidence for the role of neuro chemical processes in consciousness. In this context it is important to understand that there are two categories of drugs used to vary the level of neurotransmitters.
Q. Can you explain Bayesian Theorem? Bayesian Theorem: The predictive value of a test is related to the incidence of disease in the population. A history of typical angin
Absence of vesicular glands In some bulls the vesicular glands are either absent or hypoplastic also sometimes accompanied by poorly developed ampullae. A characteristic sympt
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Zanamivir (Relenza) Started within 2 days after onset of symptoms, this orally inhaled neuraminidase inhibitor can shorten the duration of illness and may decrease the incide
Chemical and Heat Burn Chemical born and Heat burn injuries have currently started receiving greater attention. The reason for this is perhaps the degree of discomfort and per
What is the notochord? How is this structure formed? The notochord is a rodlike structure that produces the supporting axis of the embryo and gives birth to the vertebral colum
how autophagy help in converting a tadpole larva into adult amphibian
Illustrate the Horizons in detail 'O' is the organic horizon formed from t he organic litter derived from plants and animals and fresh or partially decomposed organic materi
Q. Does thermal inversion occur in the winter or in the summer? The Pollutant low altitude thermal inversion take place in the winter and in this period of the year the sun hea
Explain Serum lipoprotiens Serum lipoprotiens:- spherical or ellipsoidal particles containing proteins, cholesterol esters and triacylglycerols, encased within a mon
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd