Explain neurochemical process, Biology

Assignment Help:

Alertness and sleep are dependent on the activity of the brain as a whole, although different levels of consciousness are determined primarily by areas of the brain stem. A key anatomical structure in the regulation of waking and sleeping, (and thus consciousness), is the reticular formation, located in the brain stem. It is a highly complex interlacing network of fiber bundles. Neuro chemically, there is a great diversity of neurotransmitters present: serotonin, mainly from the mid-line raphe nuclei; noradrenaline from the locus coeruleus; acetylcholine from pedunculopontine nuclei with also peptidergic and dopaminergic components.

The alterations in the activity of these neurotransmitters either triggers or accompany the onset of natural sleep and distinguish slow wave or non-REM from REM sleep thus providing one of the most compelling arguments in favour of chemical neurotransmission being specifically involved in mechanisms of conscious awareness.

Pharmacological manipulations of these neurotransmitters provide evidence for the role of neuro chemical processes in consciousness. In this context it is important to understand that there are two categories of drugs used to vary the level of neurotransmitters.


Related Discussions:- Explain neurochemical process

Can you explain bayesian theorem, Q. Can you explain Bayesian Theorem? ...

Q. Can you explain Bayesian Theorem? Bayesian Theorem: The predictive value of a test is related to the incidence of disease in the population. A history of typical angin

Male reproductive disorders-absence of vesicular glands, Absence of vesicul...

Absence of vesicular glands In some bulls the vesicular glands are either absent or hypoplastic also sometimes accompanied by poorly developed ampullae. A characteristic sympt

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain zanamivir, Zanamivir  (Relenza) Started within 2 days after on...

Zanamivir  (Relenza) Started within 2 days after onset of symptoms, this orally inhaled neuraminidase inhibitor can shorten the duration of illness and may decrease the incide

Chemical and heat burn, Chemical and Heat Burn Chemical born and Heat ...

Chemical and Heat Burn Chemical born and Heat burn injuries have currently started receiving greater attention. The reason for this is perhaps the degree of discomfort and per

What is the notochord, What is the notochord? How is this structure formed?...

What is the notochord? How is this structure formed? The notochord is a rodlike structure that produces the supporting axis of the embryo and gives birth to the vertebral colum

The cell, how autophagy help in converting a tadpole larva into adult amphi...

how autophagy help in converting a tadpole larva into adult amphibian

Illustrate the horizons in detail, Illustrate the Horizons in detail 'O...

Illustrate the Horizons in detail 'O'  is the  organic horizon  formed from t he organic litter derived from plants and animals and fresh or partially decomposed organic materi

Does thermal inversion occur in the winter or in the summer, Q. Does therma...

Q. Does thermal inversion occur in the winter or in the summer? The Pollutant low altitude thermal inversion take place in the winter and in this period of the year the sun hea

Explain serum lipoprotiens, Explain Serum lipoprotiens Serum lipoprot...

Explain Serum lipoprotiens Serum lipoprotiens:- spherical  or  ellipsoidal  particles containing  proteins, cholesterol esters  and  triacylglycerols, encased  within  a mon

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd