Explain mitosis properly, Biology

Assignment Help:

Q. Does the mitosis properly occur after or before the interphase? Is it a simple "point of view" issue?

Mitosis have to be considered a succeeding phase after interphase since this is a preparation step to mitosis. Thus it is not simply a point of view issue.


Related Discussions:- Explain mitosis properly

Respiration, #question.what are the organs of respiration in the lwer form ...

#question.what are the organs of respiration in the lwer form of animals .

On average what is the life duration of the red blood cells, On average wha...

On average what is the life duration of the red blood cells? Where are they destroyed? What is the destination of the heme groups after the destruction of hemoglobin molecules?

Golgi complex, Golgi complex is the organelles in animal cells having a se...

Golgi complex is the organelles in animal cells having a sequence of þattened sacs which sort, chemically modify, and package proteins produced on the rough endoplasmic reticulum.

Cells, #question.why are active cells small .

#question.why are active cells small .

Anaphase, Anaphase This  phase is of shortest duration. It  begins  wit...

Anaphase This  phase is of shortest duration. It  begins  with  a sudden  separation  of the two chromatids of each   due  to splitting   of its centromere and  then a slow mov

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define drug effects on food intake - cause dry mouth, Define drug effects o...

Define drug effects on food intake - cause dry mouth? cause dry mouth (xerostomia) : Lack of saliva makes it difficult to masticate and swallow foods, especially those of a dry

Effects on plants of air pollutants, Effects on plants of Air pollutants ...

Effects on plants of Air pollutants SO 2 , O 3 and NO 2 are strong oxidants and can bring about significant changes in plant cell chemistry. The general effects of pollutant

Significant for chromosomes, Q. Why is it significant for chromosomes to be...

Q. Why is it significant for chromosomes to be condensed during mitosis and decondensed during interphase? During mitosis the major problem to be solved is the correct separati

What is the impaired healing, Impaired Healing and Infection Because of Imp...

Impaired Healing and Infection Because of Improper Flap Design The oral field in itself is a contaminated area due to the presence of the normal oral microflora. Improper flap

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd