Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Methods of Protein Estimation?
Several methods for protein estimation are available. These methods are based on several analytical characteristics of the protein. Laboratory estimation of protein is based on any of the following principles:
i) Nitrogen estimation based on the principle of Kjeldahl's method,
ii) Estimation of tyrosine in protein (as in Lowry's method) or both phenyl alanine and tyrosine in protein (Folin's method).
iii) Biuret method - most commonly used method in clinical practice and teaching laboratories.
We have studied some of the tests in qualitative methods and the principle is the same. The Biuret method for example can be used for both qualitative and quantitative estimation of proteins. Let us learn about these methods in details. We shall, however, focus on the kjeldahl's method and the biuret method here in this section.
Q. What do ADP and ATP mean? What are the functions of these molecules for the cellular energetic metabolism? ADP is an short form of adenosine diphosphate, two molecules of ph
Evolutionary Implications of Natural Regulation Many changes in abundance can be attributed to changes in extrinsic factors such as weather, disease or predation. But some cha
Q. Write the definition of counselling? The counselling process, involves various steps in a sequence as given below: 1. Rapport-Building 2. Locating the Problem 4. Pl
Natality - Population Parameters and Regulation Natality is the ability of a population to increase. Natality rate is equivalent to birth rate which means the production of ne
Determine about the Chloroplast One of the most distinguishing features of all eukaryotic plant cells is that in addition to mitochondria, they contain special light harvesting
extensive note on the excretory system of amphibian
show heading wise characteristics of phylum platyhelmenthiese
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Biochemistry : The chemistry of living organisms that covers all the chemical reactions occurring in our body.
Explain the Behavioural Observations of the child Behavioural observations of the child are the second critical source of information available to the neuropsychologist. Qualit
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd