Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Meningococcal disease
Meningococcal vaccine is recommended for adults and children >2 years old who are traveling to areas where epidemics are occurring, or to the "meningitis belt" (semi-arid areas of subSaharan Africa extending from Senegal and Guinea eastward to Ethiopia) from December to June . Saudi Arabia requires a certificate of immunization for pilgrims during the Hajj. Immunization should also be considered for travellers who will be living in a dormitory or refugee camp, or working in a health care setting
A quadrivalent single-dose meningococcal polysaccharide vaccine (Menomune - Aventis Pasteur) is available against Neisseria meningitides serogroups A, C, Y, and W135. The duration of immunity is at least 3 years; it may be shorter in children <4 years old. Conjugate vaccines against serogroups A and C available outside the US may be more effective in children <2 years old.
If glycogen degradation and glycogen synthesis were allowed to occur concurrently, the net effect would be hydrolysis of UTP, a so-called futile cycle. To stop this, b
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Kingdom Protista The protistans are a complex and diverse group of organisms that are placed together simply because they are all single celled eukaryotes but some form rather sp
Viscosity and Plasticity of colloidal particle Various degrees of viscosity and plasticity are encountered in colloids. Viscosity may be described as resistance to pouring.
How are buffers significant to the functioning of living systems? By neutralizing small amounts of acid or base that might be added to a solution, buffers keep pH values at nor
A lot of hemodynamic information including maximum and mean velocity, maximum and mean pressure gradients and pressure half time can be obtained from Doppler trace that helps in
Types of leaves Collect leaves from such plants as lilies, bamboo, corn, willow and geraniums. View that the monocots (lily, bamboo, corn, sugar cane) have the veins running pa
what carbohydrates does a plant make from glucose
Antiviral activity
The first movements of the foetus and appearance of hair on its head are usually observed during which month of pregnancy? 1. Fourth month 2. Fifth month 3. Sixth month
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd