Explain meningococcal disease, Biology

Assignment Help:

Meningococcal disease 

Meningococcal vaccine is recommended for adults and children >2 years old who are traveling to areas where epidemics are occurring, or to the "meningitis belt" (semi-arid areas of subSaharan Africa extending from Senegal and Guinea eastward to Ethiopia) from December to June . Saudi Arabia requires a certificate of immunization for pilgrims during the Hajj. Immunization should also be considered for travellers who will be living in a dormitory or refugee camp, or working in a health care setting

A quadrivalent single-dose meningococcal polysaccharide vaccine (Menomune - Aventis Pasteur) is available against Neisseria meningitides serogroups A, C, Y, and W135. The duration of immunity is at least 3 years; it may be shorter in children <4 years old. Conjugate vaccines against serogroups A and C available outside the US may be more effective in children <2 years old.

 


Related Discussions:- Explain meningococcal disease

Glycogen degradation and glycogen synthesis , If glycogen degradation  and...

If glycogen degradation  and glycogen synthesis were allowed to occur concurrently,  the  net  effect  would  be  hydrolysis  of  UTP,  a  so-called  futile  cycle. To stop this, b

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain kingdom protista, Kingdom Protista The protistans are a complex a...

Kingdom Protista The protistans are a complex and diverse group of organisms that are placed together simply because they are all single celled eukaryotes but some form rather sp

Explain viscosity and plasticity of colloidal particle, Viscosity and Plast...

Viscosity and Plasticity of colloidal particle Various degrees of viscosity and plasticity are encountered in colloids. Viscosity may be described as resistance to pouring.

Illustrate the functioning of living systems, How are buffers significant t...

How are buffers significant to the functioning of living systems? By neutralizing small amounts of acid or base that might be added to a solution, buffers keep pH values at nor

Schematic representation of curser position of pulse wave, A lot of hemodyn...

A lot of hemodynamic information including maximum and mean velocity, maximum and mean pressure gradients and pressure half time can be obtained from Doppler trace that helps in

Types of leaves, Types of leaves Collect leaves from such plants as lil...

Types of leaves Collect leaves from such plants as lilies, bamboo, corn, willow and geraniums. View that the monocots (lily, bamboo, corn, sugar cane) have the veins running pa

Photosynthesis., what carbohydrates does a plant make from glucose

what carbohydrates does a plant make from glucose

The movements of the foetus in which month of pregnancy, The first movement...

The first movements of the foetus and appearance of hair on its head are usually observed during which month of pregnancy? 1. Fourth month 2. Fifth month 3. Sixth month

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd