Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Malnutrition
Malnutrition, impaired immunity and infection can form a triad or vicious cycle, as illustrated in Figure, which works synergistically and thus worsens the condition of an individual. For example, a patient suffering from typhoid if not provided with good nutritional support, would deteriorate his nutritional status and develop nutrient deficiencies which would be detrimental to the immune system. An impaired immune system would increase the susceptibility lo infections.
So the syilergism of malnutrition and infection must be clear. Next, let us see what metabolic changes occur during infection which impact on our nutritional needs.
Why does the urinary volume increase when alcoholic beverages are ingested? Alcohol inhibits the ADH (antidiuretic hormone) secretion by the hypophysis. Low ADH decreases the t
Explain the Food Intolerance? What is food intolerance? How does it differ from food allergy? Food intolerance like food allergy is an adverse reaction to food. Food intoleranc
ENZYMES IN CLINICAL DIAGNOSIS The rationale for measuring plasma or serum enzyme levels is based on the premise that these levels reflect changes that have occurred in a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the major divisions and representing species of the gymnosperms? This group of plants can be separated into conifers (pine, sequoia, cypress), that have flowers called
#question.what are the reason that arthropodans are abundant in nature.
Define the Requirements for Water? The body has no provision for water storage; therefore the amount of water lost every 24 hours must be replaced to maintain health and body e
what are disadvantages that protozoan causes
What are the soil-forming factors There are many degrees or variations of soil-forming factors, and the potential for creating different kinds of soil is enormous. However, whe
Economic and ecological importance of protozoans
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd