Explain malnutrition, Biology

Assignment Help:

Explain Malnutrition

Malnutrition, impaired immunity and infection can form a triad or vicious cycle, as illustrated in Figure, which works synergistically and thus worsens the condition of  an individual. For example, a patient suffering from typhoid if not provided with good nutritional support, would deteriorate his nutritional status and develop nutrient deficiencies which would be detrimental to  the immune  system. An impaired immune system would increase the susceptibility lo infections.

317_nutrition.png

So the syilergism of  malnutrition and infection must be clear. Next, let us see what metabolic changes occur during infection which impact on our nutritional needs.  

 

 


Related Discussions:- Explain malnutrition

Why does the urinary volume increase, Why does the urinary volume increase ...

Why does the urinary volume increase when alcoholic beverages are ingested? Alcohol inhibits the ADH (antidiuretic hormone) secretion by the hypophysis. Low ADH decreases the t

Explain the food intolerance, Explain the Food Intolerance? What is foo...

Explain the Food Intolerance? What is food intolerance? How does it differ from food allergy? Food intolerance like food allergy is an adverse reaction to food. Food intoleranc

Enzymes in clinical diagnosis, ENZYMES IN CLINICAL DIAGNOSIS The ration...

ENZYMES IN CLINICAL DIAGNOSIS The rationale for measuring plasma or serum enzyme levels is based on the premise that these  levels reflect changes  that  have  occurred  in  a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define major divisions & representing species of gymnosperm, What are the m...

What are the major divisions and representing species of the gymnosperms? This group of plants can be separated into conifers (pine, sequoia, cypress), that have flowers called

Animal around us, #question.what are the reason that arthropodans are abund...

#question.what are the reason that arthropodans are abundant in nature.

Define the requirements for water, Define the Requirements for Water? T...

Define the Requirements for Water? The body has no provision for water storage; therefore the amount of water lost every 24 hours must be replaced to maintain health and body e

What are the soil-forming factors, What are the soil-forming factors Th...

What are the soil-forming factors There are many degrees or variations of soil-forming factors, and the potential for creating different kinds of soil is enormous. However, whe

Assignment, Economic and ecological importance of protozoans

Economic and ecological importance of protozoans

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd