Explain leaf silhouettes, Biology

Assignment Help:

Leaf silhouettes

Place a leaf on a sheet of white paper and hold it securely with thumb or finger. Press a piece of natural or artificial sponge next to an ink pad. With short, firm strokes, rub outward around the whole edge of the leaf as shown in the diagram

2144_biology.png

 

 


Related Discussions:- Explain leaf silhouettes

Zoonoses disease-tuberculosis, Tuberculosis Tuberculosis is a specific ...

Tuberculosis Tuberculosis is a specific communicable disease involving the pulmonary and extra- pulmonary tissues and is characterized by chronic clinical manifestations. The i

Dendrology, Dendrology : This is the study of all kinds of trees. Dendrolog...

Dendrology : This is the study of all kinds of trees. Dendrology we can also say it xylology it is the science or study of wooded plants like trees, shrubs, and lianas. There is no

Plant, what is the scientific explanation of "touch me not" plant that can ...

what is the scientific explanation of "touch me not" plant that can react due to any touch

Syngamy - protozoan, Syngamy - Protozoan The two gametes may be morpho...

Syngamy - Protozoan The two gametes may be morphologically similar (isogametes) or dissimilar (anisogametes). The gametes also vary in form, they may be flagellated or amoeboi

What are the types of chronic gastritis, Q. What are the types of chronic g...

Q. What are the types of chronic gastritis? Gastroscopic observation shows different types of chronic gastritis: 1. Superficial gastritis: gastric mucosa is red, oedematous,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Precaution for quantitative determination of viable microbes, Define Precau...

Define Precautions for Quantitative Determination of Viable Microbes? 1. Dilution should be made carefully. 2. Use fresh sterile pipette for making each dilution. 3. Asep

Tissue, how does the structure of epithelial tissue allows it to fulfil its...

how does the structure of epithelial tissue allows it to fulfil its function

The luria-nebraska neuropsychological battery, The luria-nebraska neuropsyc...

The luria-nebraska neuropsychological battery This procedure was first reported in 1978 in the form of two initial validity studies. Historically, Chirstensen, a student of the

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd