Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Le Compte Operation-REV Procedure ?
This is an alternative type of repair for TGA, VSD and left ventricular outflow obstruction (LVOTQ). In this operation an extrinsic conduit is not used.
Initial steps of the operation are the same as for n Rastelli repair. After establishing CP bypass and aorta is cross clamped, cold cardioplegic arrest is achieved. Left side of the heart is vented. Intra ventricular tunnel repair of VSD is done to divert 1eft ventricular flow to the aorta. The pulmonary trunk is divided distal to the valve and proximal part sutured. The well-mobilized pulmonary artery is brought anterior to the aorta (le Compte maneuvre as in a switch operation). The transacted aorta is then reconstructed post&or and to the left of the pulmonary artery. The posterior part of the pulm6nq artery is sutured to the upper end of right ventriculotomy. Using a pericardial patch, reconstruction of the right ventriculotomny and that of anterior part of pulmonary artery is done. The disadvantage of the operation is that there is no valve in the pulmonary outflow. However, it has the advantage of growth of pulmonary artery as no synthetic conduit is used.
what is the necessity of interdependence of a volvox organism in the colonial existence?
Define the Process of Digestion of Proteins? The daily protein intake (of about 50-100 g) and the protein of enzymes, sloughed (bled or drop off) epithelial cells and mucins, w
Q. Nutritional Management for lactose intolerance? Diagnostic tests are available that can give information about the level and activity of the lactase enzyme. Depending on the
What is Schistosomiasis? Explain in brief. A disease cause by the trematode parasite Schistosoma found around the world. Numerous species are responsible for diseases ranging f
Eastern/Western/Venezuelan equine encephalitis This encephalitis causing group of viral diseases of wild birds including pheasants, chickens, turkeys, ducks and pigeons with a
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Gaseous fuels are increasingly used in industrial as well as domestic uses. Gaseous fuels have very high calorific value and comparatively higher thermal efficiency than solid and
Exploitation of Forests Exploitation of our forests for commercial purposes and for food and fodder cannot be stopped completely because of symbiotic relationship between fore
order of the phylum protozoa
Microorganisms and Plants can synthesize all of the 20 standard amino acids. Mammals, furthermore, cannot synthesize all 20 and must obtain some of them in their diet. Those amin
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd