Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Kingdom AnimaliaMulticellular, heterotrophic, eukaryotes, tissues are specialised and most of them have organs, mostly highly responsive. Only gametes are haploid, fertilisation occurs without intervening of haploid cycle. Sperm is flagellated. An egg is large, typical and stationary.
Noncompetitive inhibition In this type of inhibition, the inhibitor binds at a site on the enzyme other than catalytic site. As there is no competition between the s
Q. Explain Left Ventricle Enlargement? The left ventricle (LV) is ellipsoid in shape. It lies behind, and to the left of the right ventricle. Its long axis lies at about 45 deg
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In the living condition (found in sea) you would be able to observe the following features in radiolarians: The cytoplasm is divided by a perforated and chitinous metnbrane into
What is the difference between homozygosity and heterozygosity? Homozygosity happens when an individual has two identical alleles of a gene, for instance, AA or aa. Heterozygos
Annuloplasty with a Ring : The lings commonly used are Carpentier- Edwards and Cosgrove's flexible half ring. The rings are C shaped and have incomplete circles to accommoda
why does the monohybrid always result in a 1:2:1 ratio?
Research methods used in studying a genetic disease change with technological advances. These changes can be seen in Reading 22.1: Discovering the Huntington Disease Gene, which de
Considering the hybridization in a trait like the color of the flowers of a given plant species (red/yellow) conditioned by a pair of different alleles in relation to complete domi
Immunotoxin is formed by conjugating or combining an antibody with highly toxic agent.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd