Explain inhibition of cancer cell proliferation and growth, Biology

Assignment Help:

Explain Inhibition of cancer cell proliferation and growth?

Vitamin D diminishes proliferation of abnormal intestinal, lymphatic, mammary and skeletal cells and provides a potential for the treatment of skin diseases such as psoriasis (a disorder in which there is proliferation of the keratinocytes and a failure to differentiate rapidly).


Related Discussions:- Explain inhibition of cancer cell proliferation and growth

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Mention the main cause of air pollution in metro cities, a) Mention the mai...

a) Mention the main cause of air pollution in metro cities. Write any three ways by which it can be decreased. b) How did Eli Lilly synthesize the human insulin? Mention

Explain about human sperm, Which one of the following statements about huma...

Which one of the following statements about human sperm is correct? 1. Acrosome has a conical pointed structure used for piercing and penetrating the egg, resulting in fertilis

Define maxillofacial prosthodontics, Q. Define Maxillofacial Prosthodontics...

Q. Define Maxillofacial Prosthodontics? Dental implants are now been increasingly used for Maxillofacial Prosthodontics. Maxillofacial Prosthodontics involves the prosthetic re

Liver function test, Liver function test should be done for all diabetic pa...

Liver function test should be done for all diabetic patients. This will help the doctor in the choice of drugs for the treatment of diabetes since liver abnormalities influence the

What are the uses of formycin b, What are the uses of formycin B? Formy...

What are the uses of formycin B? Formycin B is a drug used to demolish of intestinal parasites.

Traditional uses of dung, T r ad i tional Uses of dung Dung has an ...

T r ad i tional Uses of dung Dung has an astonishing and myriad variety of uses which have been developed over a period of time. Dung patties ( gootee ) are mainly used by

What is the difference between taeniasis and cysticercosis, Q. What is the ...

Q. What is the difference between taeniasis and cysticercosis? The Taeniasis is the parasitic disease caused by the adult tapeworm installed within the human intestine. The

How can you convert 147.05mg%, How do you convert 147.05mg% of plasma gluco...

How do you convert 147.05mg% of plasma glucose to mM/L please show work.

Determine the evaluation of the bone, Evaluation of the bone Evaluation...

Evaluation of the bone Evaluation of the bone -implant interface needs to be done by the following: Failures in Implant Dentistry 1) Implant mobility and discomfort 2)

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd