Explain hydraulic formula, Biology

Assignment Help:

Q. Explain Hydraulic Formula?

This relates to pressure gradient and velocity of flow:

V2 = (Cv)2 2gh or V = (Cv) 2gh

Wherein, V = velocity of flow
Cv = coefficient of velocity

g = acceleration due to gravity (980 cm/sec/sec)

h = pressure gradient in cm of H2O

Combining these two equations, we get:

The final equation for calculation of valve orifice area A in cm2 is:

Where, CO = Cardiac output in cm3/ min

DFP = diastolic filling period (sec/beat)

SEP = systolic ejection period (sec/beat)

HR = heart rate (beats/min)

C = empirical constant

P = pressure gradient


Related Discussions:- Explain hydraulic formula

Classification of drugs, CLASSIFICATION OF GENERAL DRUGS - 1 .       ...

CLASSIFICATION OF GENERAL DRUGS - 1 .       NATURAL DRUGS - Obtained from natural sources as minerals, animals, plants & microorganism. (i)       Minerals - It include

Why photosynthetic prokaryotes appeared before more, Why is it more probabl...

Why is it more probable that the photosynthetic prokaryotes appeared before the aerobic eukaryotes? It is more feasible that photosynthetic prokaryotes appeared before the aero

Explain multidrug resistance, Multidrug Resistance  Treatment of MDRTB ...

Multidrug Resistance  Treatment of MDRTB is  based on limited data; patients should be referred, if possible, to clinicians who have experience in treating such cases. MDRTB (r

Describe false negaive tests, Q. Describe False Negaive Tests? When pat...

Q. Describe False Negaive Tests? When patients are found to have significant coronary narrowing and fail to have exercise induced ST depression, they have been labeled false ne

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define uses of microbes in industry, Normal 0 false false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Show complications of mitral stenosis, Q. Show Complications of Mitral Sten...

Q. Show Complications of Mitral Stenosis ? Hemoptysis It is a common complication in patients with mitral stenosis and is related to the severity of mitral stenosis. Pulm

Define metabolic response to food - requirement of energy, Define Metabolic...

Define Metabolic response to food - Requirement of Energy? Eating requires energy for the ingestion and digestion of food, and for the absorption, transport, inter conversion,

How do the availability of water and light affect population, How do the av...

How do the availability of water and light and the climate affect the growth of a population? The availability of water and light and the climate are abiotic factors that limi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd