Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Explain Hydraulic Formula?
This relates to pressure gradient and velocity of flow:
V2 = (Cv)2 2gh or V = (Cv) 2gh
Wherein, V = velocity of flow Cv = coefficient of velocity
g = acceleration due to gravity (980 cm/sec/sec)
h = pressure gradient in cm of H2O
Combining these two equations, we get:
The final equation for calculation of valve orifice area A in cm2 is:
Where, CO = Cardiac output in cm3/ min
DFP = diastolic filling period (sec/beat)
SEP = systolic ejection period (sec/beat)
HR = heart rate (beats/min)
C = empirical constant
P = pressure gradient
CLASSIFICATION OF GENERAL DRUGS - 1 . NATURAL DRUGS - Obtained from natural sources as minerals, animals, plants & microorganism. (i) Minerals - It include
Why is it more probable that the photosynthetic prokaryotes appeared before the aerobic eukaryotes? It is more feasible that photosynthetic prokaryotes appeared before the aero
Multidrug Resistance Treatment of MDRTB is based on limited data; patients should be referred, if possible, to clinicians who have experience in treating such cases. MDRTB (r
Q. Describe False Negaive Tests? When patients are found to have significant coronary narrowing and fail to have exercise induced ST depression, they have been labeled false ne
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Q. Show Complications of Mitral Stenosis ? Hemoptysis It is a common complication in patients with mitral stenosis and is related to the severity of mitral stenosis. Pulm
Define Metabolic response to food - Requirement of Energy? Eating requires energy for the ingestion and digestion of food, and for the absorption, transport, inter conversion,
How do the availability of water and light and the climate affect the growth of a population? The availability of water and light and the climate are abiotic factors that limi
respiration in animals
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd