Explain high fibre diets, Biology

Assignment Help:

High fibre diets

High fibre  diets: The patients  are advised  to  eat  high  fibre cereals as whole grain flour and bread, whole grain bread cereals, whole wheat pasta and brown rice, all kinds of fruits and vegetables (with their-edible peels). Unprocessed bran call also is added to cereals or soups to give more fibre.

 


Related Discussions:- Explain high fibre diets

How are lipids classified, Regarding solubility, how are lipids classified?...

Regarding solubility, how are lipids classified? Fats and oils are hydrophobic molecules, i.e., they are non polar and insoluble in water. Lipids in general are molecules with

Free-hand sectioning of plant tissue (stem), What are the processes involve...

What are the processes involved in the preparation of plant tissue for free hand sectioning?

How body fat can be measured, How body fat can be measured? The convent...

How body fat can be measured? The conventional golden method of measuring BF% is by underwater weighing. Difference of weight in air and in water gives density, from which the

Zearalenone, Zearalenone It was first isolated as the agent responsibl...

Zearalenone It was first isolated as the agent responsible for vulvovaginitis in pigs has very little acute toxicity, but there should be some concern about chronic exposure t

Explain about cold preservation - methods of food processing, Explain about...

Explain about Cold Preservation - methods of food processing? The metabolism of a living tissue is a function of the temperature of the environment. Low temperatures are used t

Are sex-linked diseases associated to genes of x chromosome, Are sex-linked...

Are sex-linked diseases associated only to genes of the X chromosome? There are so many X-linked diseases such like, hemophilia B, hemophilia A and adrenoleukodystrophy, but re

Define quest of nutrition required for excercise, Define quest of nutrition...

Define quest of nutrition as sports nutrition as a discipline? Although the quest of nutrition as applied to exercise and sports dates back to ancient civilizations and importa

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain huntington disease gene, Research methods used in studying a geneti...

Research methods used in studying a genetic disease change with technological advances. These changes can be seen in Reading 22.1: Discovering the Huntington Disease Gene, which de

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd