Explain heterozygous individual and homozygous individual, Biology

Assignment Help:

What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual?

This situation is called lack of dominance and it can happen in two ways: incomplete codominance or dominance.

In the incomplete dominance the heterozygous presents an intermediate phenotype between the two kinds of homozygous, as in sickle cell anemia in which the heterozygous produces some sick red blood cells and some normal red blood cells. Codominance occurs, for example, in the genetic determination of the MN blood group system, in which the heterozygous has a phenotype totally different from the homozygous, not being an intermediate form.

 


Related Discussions:- Explain heterozygous individual and homozygous individual

Diastolic heart failure, Unfortunately, unlike heart failure due to systoli...

Unfortunately, unlike heart failure due to systolic dysfunction, diastolic heart failure has been studied in few clinical trials, so there is little evidence to guide the care of p

Explain both food and light as zeitgebers, Must account for both food AND l...

Must account for both food AND light as zeitgebers Because of the continuous light / dark periods of the year; light not always able to act as a zeitgeber. Food

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Function of the cornified layer of the skin, What are the main functions of...

What are the main functions of (a) the basal (Malpighian) layer, (b) the cornified layer of the skin?   (a) The basal (Malpighian) layer makes new skin cells and the pigment

Trisaccharides, TRISACCHARIDES The oligosaccharides are made of three m...

TRISACCHARIDES The oligosaccharides are made of three monosaccharide residues. A common trisaccharides is Raffinose which is formed by condensation of galactose-glucose-fr

What in genetics is hybridization, What in Genetics is hybridization? T...

What in Genetics is hybridization? The Hybridization in Genetics is the crossing of individuals from "pure" and different lineages in relation to a given trait that is the cros

How does hypophysis- corpus luteum negative feedback work, Q. How does the ...

Q. How does the hypophysis- corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estroge

Briefly explain about semantides, Q. Briefly explain about semantides? ...

Q. Briefly explain about semantides? The information carrying molecules in plants are called semantides, and they have been recognised to be 3 kinds; deoxyribonucleic acid or D

Respiratory system, whats the difference in respiratory system in mammals,r...

whats the difference in respiratory system in mammals,reptilia and amphibian?

Chromsome, How does a person with drown syndrome obtain a third chromosome ...

How does a person with drown syndrome obtain a third chromosome 21?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd