Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual?
This situation is called lack of dominance and it can happen in two ways: incomplete codominance or dominance.
In the incomplete dominance the heterozygous presents an intermediate phenotype between the two kinds of homozygous, as in sickle cell anemia in which the heterozygous produces some sick red blood cells and some normal red blood cells. Codominance occurs, for example, in the genetic determination of the MN blood group system, in which the heterozygous has a phenotype totally different from the homozygous, not being an intermediate form.
Unfortunately, unlike heart failure due to systolic dysfunction, diastolic heart failure has been studied in few clinical trials, so there is little evidence to guide the care of p
Must account for both food AND light as zeitgebers Because of the continuous light / dark periods of the year; light not always able to act as a zeitgeber. Food
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the main functions of (a) the basal (Malpighian) layer, (b) the cornified layer of the skin? (a) The basal (Malpighian) layer makes new skin cells and the pigment
TRISACCHARIDES The oligosaccharides are made of three monosaccharide residues. A common trisaccharides is Raffinose which is formed by condensation of galactose-glucose-fr
What in Genetics is hybridization? The Hybridization in Genetics is the crossing of individuals from "pure" and different lineages in relation to a given trait that is the cros
Q. How does the hypophysis- corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process? After ovulation the estroge
Q. Briefly explain about semantides? The information carrying molecules in plants are called semantides, and they have been recognised to be 3 kinds; deoxyribonucleic acid or D
whats the difference in respiratory system in mammals,reptilia and amphibian?
How does a person with drown syndrome obtain a third chromosome 21?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd