Explain hemicellulose, Biology

Assignment Help:

Hemicellulose

In plant cell walls, the most abundant compound present is α-cellulose with long fibers embedded in a matrix of cementing compounds (matrix polysaccharides). These compounds are alkali soluble and are called as hemicelluloses. They constitute about 20-30% of plant cell walls.

Hemicellulose is defined as a large polysaccharide, which helps give structure to plant cells.  Hemicellulose gives fruits and vegetables crisp, chewy, fibrous characteristics that partially remain after cooking. Along with pectin, it forms an amorphous matrix in which cellulose fibrils from the plant cell walls are embedded.  It has the chemical formula of C6H10O5 and consists of a chain of D-xylose sugar units which has side chains of units of other sugars branching off it.

 


Related Discussions:- Explain hemicellulose

Express the three functional classifications of joints, In general compare ...

In general compare and contrast the three functional classifications of joints according to movement.

Determine biologically compatibility of implant materials, Biologically com...

Biologically compatibility od implant materials An ideal implant material will elicit mainly physiological reactions within the surrounding tissues (bone, connective tissue and

What is dyslipidemia or hyperlipidemia, Q. What is Dyslipidemia or Hyperlip...

Q. What is Dyslipidemia or Hyperlipidemia? It has been known for over five decades now that dyslipidemia is associated with increased severity and prevalence of atherosclerosis

Phenotypic classes, 1. A pure-breeding black, smooth guinea pig was mated t...

1. A pure-breeding black, smooth guinea pig was mated to a pure-breeding white, rough female. They produced several litters, and eventually, five males and twenty females resulted

State the medial pterygoid, Medial pterygoid Muscle bounds the pterygom...

Medial pterygoid Muscle bounds the pterygomandibular space medially which is entered when an inferior alveolar nerve block is administered. Infection of this space is dangerous

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The prs kit for post removal uses-endodontics principles, The PRS kit is co...

The PRS kit is comprised of          -5 variously sized trephines and corresponding tubes according to material if it's silver or silver point          -A transmetal bur

Explain the oligosaccharides (dp: 3-9) - carbohydrates, Explain the Oligosa...

Explain the Oligosaccharides (DP: 3-9) - carbohydrates? Oligosaccharides consists of short chains of monosaccharide units joined by covalent bonds. The glycosidic bond may be α

The cell, how does autophagy help in converting a tadpole larva into an adu...

how does autophagy help in converting a tadpole larva into an adult amphibian

Conductometry, Highlight ten applications of conductometry and explain four...

Highlight ten applications of conductometry and explain four in detail

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd