Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Glycogenolysis
Unlike glycogenesis, glycogenolysis is the breakdown of glycogen. Glycogen is broken down in the liver and muscle catalysed by the enzyme glycogen phosphorylase. Inorganic phosphate (Pi) is used for the lysis and hence is called phosphorolysis. Phosphorylase specifically acts upon a 1 →4 linkage of glycogen to produce glucose-1- phosphate. The removal of al,4 glucosyl residues continues until about 4 glucose residues remain on either side of a-1,6 branch, then the debranching enzyme (amylo a 1,6 glucosidase) causes the hydrolytic splitting of a 1,6 linkages. Here free glucose is formed (since no phosphate is used for lysis).
Trans Myocardial laser re vascularisation (TMLR) : Patients who have severe angina and diffuse coronary artery disease with no graftable vessels are at limes subjected to TMLR. I
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Gastrointestinal tract - Excretion of Zinc in Humans? Majority of zinc is lost from the body in faeces. Endogenous zinc in the form of enzymes or metallo-proteins is sec
Define Types of Non Enzymatic Browning Reaction? Two major types of non enzymatic browning reaction have been recognized to occur in foods during processing. 1. Maillard Rea
Oil seed meals as source of limiting amino acids Generally ruminants are not perceived to have a requirement for essential amino acids as the rumen microbes can synthesis esse
Educating a patient with diabetes mellitus. At this point you have understood in detail about diabetes mellitus, its management and complications. You can appreciate now why it is
Define Reagent for Separation of Amino Acid by Paper Chromatography? The following reagents will be required for carrying out the experiment: 1. Amino acid solution- Weig
An egg osmometer Place some dilute hydrochloric acid or strong vinegar in a shallow dish, likeas a saucer, to a depth of about one centimetre. Hold the large end an egg in the
Define Interaction of niacin with other Nutrients? You may recall reading earlier that trypotophan present in dietary proteins is converted to niacin. There is an interdepend
Protein structure is determined solely by a protein amino acid sequence. Should a genetically engineered protein in which the order of all amino acids is reversed therefore have th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd