Explain glycogenolysis, Biology

Assignment Help:

Glycogenolysis

Unlike glycogenesis, glycogenolysis is the  breakdown of glycogen. Glycogen is  broken down  in  the  liver and muscle catalysed  by  the  enzyme glycogen phosphorylase. Inorganic  phosphate (Pi)  is used  for  the  lysis and hence  is called  phosphorolysis. Phosphorylase specifically acts upon a 1 →4  linkage of  glycogen  to produce glucose-1- phosphate. The  removal of  al,4  glucosyl  residues continues  until about 4 glucose residues remain on either side of a-1,6  branch, then  the debranching enzyme  (amylo  a 1,6 glucosidase)  causes the hydrolytic splitting  of  a 1,6  linkages. Here free  glucose  is  formed (since no phosphate  is used  for  lysis).

 


Related Discussions:- Explain glycogenolysis

Metamorphosis, ME T AMORPHOSIS The differentiation results in the for...

ME T AMORPHOSIS The differentiation results in the formation of larva / infant. The formation of adult from the larva / infant is called as metamorphosis. The metamorph

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define vitamins required for underweight - nutritional care, Define Vitamin...

Define Vitamins required for underweight - nutritional care? If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplements are usually not re

What are the possible effects on the fetus, What are the possible effects o...

What are the possible effects on the fetus if, during pregnancy, the mother (a) smokes, (b) catches rubella?   a) Smoking during pregnancy can lead to an underwe

Explain viscosity and plasticity of colloidal particle, Viscosity and Plast...

Viscosity and Plasticity of colloidal particle Various degrees of viscosity and plasticity are encountered in colloids. Viscosity may be described as resistance to pouring.

Illustrate maintenance of high levels of dissolved solutes, Which of the fo...

Which of the following processes assist in the maintenance of high levels of dissolved solutes in the interstitial spaces of the kidney medulla? A. Net flux of sodium ions from

Reason''s for mendel''s success, REASON'S FOR MENDEL'S SUCCESS 1.      ...

REASON'S FOR MENDEL'S SUCCESS 1.         Mendel selected only pure breeding varieties of pea ( Pisum sativum ) for his experiments. 2.         Mendel took only those traits

Illustrate the important rules of nomenclature, Q. Illustrate the Important...

Q. Illustrate the Important rules of nomenclature? Nomenclature is allied to taxonomy as it deals with the determination of the correct name to be applied to a known taxon. The

Sensor measures the current value of the controlled variable, In a properly...

In a properly functioning negative feedback system A. value of the controlled variable will always be very close to the threshold value when the system is in steady state.

Problem of polarity in regeneration in planarians, Problem of Polarity in R...

Problem of Polarity in Regeneration in Planarians As in Hydra, flatworm regeneration as well appears to occur in a polar fashion. There seems to be ananterior-posterior gradie

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd