Explain glycogenolysis, Biology

Assignment Help:

Glycogenolysis

Unlike glycogenesis, glycogenolysis is the  breakdown of glycogen. Glycogen is  broken down  in  the  liver and muscle catalysed  by  the  enzyme glycogen phosphorylase. Inorganic  phosphate (Pi)  is used  for  the  lysis and hence  is called  phosphorolysis. Phosphorylase specifically acts upon a 1 →4  linkage of  glycogen  to produce glucose-1- phosphate. The  removal of  al,4  glucosyl  residues continues  until about 4 glucose residues remain on either side of a-1,6  branch, then  the debranching enzyme  (amylo  a 1,6 glucosidase)  causes the hydrolytic splitting  of  a 1,6  linkages. Here free  glucose  is  formed (since no phosphate  is used  for  lysis).

 


Related Discussions:- Explain glycogenolysis

Trans myocardial laser re vascularisation, Trans Myocardial laser re vascul...

Trans Myocardial laser re vascularisation (TMLR) :  Patients who have severe angina and diffuse coronary artery disease with no graftable vessels are at limes subjected to TMLR. I

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define gastrointestinal tract - excretion of zinc in humans, Define Gastroi...

Define Gastrointestinal tract - Excretion of Zinc in Humans? Majority of zinc is lost from the body in faeces. Endogenous zinc in the form of enzymes or metallo-proteins is sec

Define types of non enzymatic browning reaction, Define Types of Non Enzyma...

Define Types of Non Enzymatic Browning Reaction? Two major types of non enzymatic browning reaction have been recognized to occur in foods during processing. 1. Maillard Rea

Oil seed meals as source of limiting amino acids, Oil seed meals as source ...

Oil seed meals as source of limiting amino acids Generally ruminants are not perceived to have a requirement for essential amino acids as the rumen microbes can synthesis esse

Patient with diabetes mellitus, Educating a patient with diabetes mellitus....

Educating a patient with diabetes mellitus. At this point you have understood in detail about diabetes mellitus, its management and complications. You can appreciate now why it is

Reagent for separation of amino acid by paper chromatography, Define Reagen...

Define Reagent for Separation of Amino Acid by Paper Chromatography? The following reagents will be required for carrying out the experiment: 1. Amino acid solution- Weig

Experiment of an egg osmometer, An egg osmometer Place some dilute hydr...

An egg osmometer Place some dilute hydrochloric acid or strong vinegar in a shallow dish, likeas a saucer, to a depth of about one centimetre. Hold the large end an egg in the

Define interaction of niacin with other nutrients, Define Interaction of ...

Define Interaction of niacin with other Nutrients? You may recall reading earlier that trypotophan present in dietary proteins is converted to niacin. There is an interdepend

Define a protein amino acid sequence, Protein structure is determined solel...

Protein structure is determined solely by a protein amino acid sequence. Should a genetically engineered protein in which the order of all amino acids is reversed therefore have th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd