Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Glycogenolysis
Unlike glycogenesis, glycogenolysis is the breakdown of glycogen. Glycogen is broken down in the liver and muscle catalysed by the enzyme glycogen phosphorylase. Inorganic phosphate (Pi) is used for the lysis and hence is called phosphorolysis. Phosphorylase specifically acts upon a 1 →4 linkage of glycogen to produce glucose-1- phosphate. The removal of al,4 glucosyl residues continues until about 4 glucose residues remain on either side of a-1,6 branch, then the debranching enzyme (amylo a 1,6 glucosidase) causes the hydrolytic splitting of a 1,6 linkages. Here free glucose is formed (since no phosphate is used for lysis).
ME T AMORPHOSIS The differentiation results in the formation of larva / infant. The formation of adult from the larva / infant is called as metamorphosis. The metamorph
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Vitamins required for underweight - nutritional care? If the diet provides good amounts of fresh fruits and vegetables, vitamin or mineral supplements are usually not re
What are the possible effects on the fetus if, during pregnancy, the mother (a) smokes, (b) catches rubella? a) Smoking during pregnancy can lead to an underwe
Viscosity and Plasticity of colloidal particle Various degrees of viscosity and plasticity are encountered in colloids. Viscosity may be described as resistance to pouring.
Which of the following processes assist in the maintenance of high levels of dissolved solutes in the interstitial spaces of the kidney medulla? A. Net flux of sodium ions from
REASON'S FOR MENDEL'S SUCCESS 1. Mendel selected only pure breeding varieties of pea ( Pisum sativum ) for his experiments. 2. Mendel took only those traits
Q. Illustrate the Important rules of nomenclature? Nomenclature is allied to taxonomy as it deals with the determination of the correct name to be applied to a known taxon. The
In a properly functioning negative feedback system A. value of the controlled variable will always be very close to the threshold value when the system is in steady state.
Problem of Polarity in Regeneration in Planarians As in Hydra, flatworm regeneration as well appears to occur in a polar fashion. There seems to be ananterior-posterior gradie
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd