Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Gene Expression - Nutrient Gene Interactions?
The last two decades have witnessed tremendous development in our understanding of the cellular processes at the molecular level including the mechanism of action of certain nutrients. This has been feasible largely by the application of modern molecule and cellular biological techniques within the discipline of nutrition. DNA (deoxyribonucleic acid) in all cells of a species, we already know, carries all of the genes for all the body's characteristics. However, not all genes are expressed in all cells at all times. Controls of gene expression exist, that determine which genes are transcribed and translated into gene products. Besides metabolic control mechanisms, which involve hormones, metabolites, ions, second messenger systems and others modify the phenotypic expression of genes.
Dietary factors, which include both nutritive and non-nutritive components, can influence gene expression at various levels. Specific nutrients can turn on or turn off specific genes. Nutrient-gene interactions have the potential to influence the life process from conception through growth and development to adulthood. These interactions are also likely to determine healthy life span by influencing both infectious and chronic degenerative diseases.
Although the Human Genome Project has unravelled the genetic code, gene expression is a process that is still under investigation. An understanding of the molecular mechanisms underlying human health and disease is fundamental to both prevention and treatment of disease. Ultimately, as knowledge about genetic identity expands and gene-nutrient interactions are well understood, nutritionists may be able to recommend nutrient intakes that enhance the expression of genes associated with good health and suppress the expression ,of genes associated with disease.
Describe the uses of pupil Variation in the size, shape or reaction usually indicates some form of disease, disorder or use of medication. The pupil is usually dilated by the u
An impermeable membrane separates one liter of a 1M KCl solution in the left compartment from one liter of 1M NaCl solution in the right compartment. At 2 AM today the membrane be
PARATHYROID DISORDERS - (i) Hypoparathyroidism (deficiency of PTH) . It causes the lowering of blood calcium level. This increases the excitability of nerves and muscles, caus
Why is water conservation in c3 c4 and cam plants important? Cam stands for Crassulacean acid metabolism. C3 and C4 conserve less water than Cam plants. Actually, C4 plan
Determine the name of Material used for BCC You must be interested to know about type of material you can prepare and some material is available in hospitals and clinics for us
Q. Which is the kingdom of the parasites that cause malaria and Chagas' disease? Those maladies are caused by the protozoans, beings of the kingdom Protista. Q. What is the
Why roots of many swamp plants have a special morphology? The Swamp and The marsh plants in general present supporting roots that ramify from portions of the stem above the gro
Proteolytic enzymes They catalyze the hydrolysis of peptide bonds in other proteins. In order to prevent them doing generalized damage to all cellular proteins, they are often
Assessment of Tricuspid and Pulmonary Orifice Areas Due to the rarity of tricuspid stenosis and pulmonary stenosis, no general agreement exists on what constitutes critical o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd