Explain gene expression - nutrient gene interactions, Biology

Assignment Help:

Explain Gene Expression - Nutrient Gene Interactions?

The last two decades have witnessed tremendous development in our understanding of the cellular processes at the molecular level including the mechanism of action of certain nutrients. This has been feasible largely by the application of modern molecule and cellular biological techniques within the discipline of nutrition. DNA (deoxyribonucleic acid) in all cells of a species, we already know, carries all of the genes for all the body's characteristics. However, not all genes are expressed in all cells at all times. Controls of gene expression exist, that determine which genes are transcribed and translated into gene products. Besides metabolic control mechanisms, which involve hormones, metabolites, ions, second messenger systems and others modify the phenotypic expression of genes.

Dietary factors, which include both nutritive and non-nutritive components, can influence gene expression at various levels. Specific nutrients can turn on or turn off specific genes. Nutrient-gene interactions have the potential to influence the life process from conception through growth and development to adulthood. These interactions are also likely to determine healthy life span by influencing both infectious and chronic degenerative diseases.

Although the Human Genome Project has unravelled the genetic code, gene expression is a process that is still under investigation. An understanding of the molecular mechanisms underlying human health and disease is fundamental to both prevention and treatment of disease. Ultimately, as knowledge about genetic identity expands and gene-nutrient interactions are well understood, nutritionists may be able to recommend nutrient intakes that enhance the expression of genes associated with good health and suppress the expression ,of genes associated with disease. 


Related Discussions:- Explain gene expression - nutrient gene interactions

Describe the uses of pupil, Describe the uses of pupil Variation in the...

Describe the uses of pupil Variation in the size, shape or reaction usually indicates some form of disease, disorder or use of medication. The pupil is usually dilated by the u

Explain the chloride permeability, An impermeable membrane separates one li...

An impermeable membrane separates one liter of a 1M KCl solution in the left compartment from one liter of 1M NaCl solution in the right compartment.  At 2 AM today the membrane be

Parathyroid disorders, PARATHYROID DISORDERS - (i) Hypoparathyroidism ...

PARATHYROID DISORDERS - (i) Hypoparathyroidism (deficiency of PTH) . It causes the lowering of blood calcium level. This increases the excitability of nerves and muscles, caus

Why is water conservation in c3 c4 and cam plants important, Why is water c...

Why is water conservation in c3 c4 and cam plants important? Cam stands for Crassulacean acid metabolism. C3 and C4 conserve less water than Cam plants. Actually, C4 plan

Determine the name of material used for bcc, Determine the name of Material...

Determine the name of Material used for BCC You must be interested to know about type of material you can prepare and some material is available in hospitals and clinics for us

Scientific name of the etiological agent of chagas disease, Q. Which is the...

Q. Which is the kingdom of the parasites that cause malaria and Chagas' disease? Those maladies are caused by the protozoans, beings of the kingdom Protista. Q. What is the

Why roots of many swamp plants have a special morphology, Why roots of many...

Why roots of many swamp plants have a special morphology? The Swamp and The marsh plants in general present supporting roots that ramify from portions of the stem above the gro

Define proteolytic enzymes, Proteolytic enzymes They catalyze the hydro...

Proteolytic enzymes They catalyze the hydrolysis of peptide bonds in other proteins. In order to prevent them doing generalized damage to all cellular proteins, they are often

Assessment of tricuspid and pulmonary orifice areas, Assessment of Tricusp...

Assessment of Tricuspid and Pulmonary Orifice Areas Due to the rarity of tricuspid stenosis and pulmonary stenosis, no general agreement exists on what constitutes critical o

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd