Explain factors influencing lipid oxidation, Biology

Assignment Help:

Factors Influencing Lipid Oxidation

Food lipids contain a variety of fatty acids that differ in chemical and physical properties and also in their susceptibility to oxidation.

In addition, foods contain numerous non lipid components that may co-oxidize and / or interact with the oxidizing lipids and their oxidation products. Oxygen concentration, temperature and moisture are the other factors influencing autoxidation.

Related Discussions:- Explain factors influencing lipid oxidation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by platyhelminth phylum, Q What are the most tremendous kn...

Q What are the most tremendous known representatives of the platyhelminth phylum? The most popular representatives of the platyhelminthes are worms that cause human diseases, l

Cardiac output and its determination, The cardiac output is the volume of b...

The cardiac output is the volume of blood pumped from the heart every minute. It is obtained by the volume pumped with each beat (stroke volume) multiplied by the heart rate. The c

The structure of epithelium, what are the structures of epithelium

what are the structures of epithelium

Bacterial diseases - colisepticemia, Bac t e r i a l diseases C ...

Bac t e r i a l diseases C o lisepticemia Colisepticemia, also known as colibacillosis caused by Escherichia coli, is the commonest disease condition in ill-mana

How is the nervous tissue distributed in cnidarians, Q. How is the nervous ...

Q. How is the nervous tissue distributed in cnidarians? Their nervous system is diffuse there are no ganglia or brain. Q. What are the kinds of reproduction presented by cn

Define binding of protein with other compounds, Define Binding of Protein w...

Define Binding of Protein with Other Compounds? In addition to water, lipids and volatile flavours, food proteins can bind a number of other substances through weak interaction

Blood flow, if i start in the superior mesenteric vain where do i have to g...

if i start in the superior mesenteric vain where do i have to go through to get to the left anterior circumflex humeral artery. by the way of the hepatic portal vein and the heart

Verify that the transforming agent in a bacteriophage, Which of the followi...

Which of the following experimental steps permitted Hershey and Chase to verify that the transforming agent in a bacteriophage is DNA as well? A. Phage particles were mixed wit

Explain electrocardiography, Explain electrocardiography? What is mean...

Explain electrocardiography? What is meant by P-Q interval and S -T interval in electrocardiography? Mention two medical applications of this method.

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages