Explain evolutionary classification, Biology

Assignment Help:

Evolutionary Classification

Evolutionary classification combines aspects of both phenetic and cladistic systematic. Evolutionary taxonomists attempt to show in their classification both the evolutionary relationships and the degrees of similarity among organisms. It is impossible, however, to represent both similarities and genealogies accurately in a single classification system because rates of evolution among groups of organisms and among different traits within groups of organisms are often highly variable. Therefore, evolutionary taxonomists must compromise between their 'two goals. This need not be confusing as long as the nature of the compromise is clearly indicated so that users of the system know how the taxonomic categories were constructed. With a simple and hypothetical example we can illustrate how different approaches lead to different classification of organisms even when they use the same data. Six characters have been measured, and each one can have either the ancestral state (0) or a derived one (1). In this example, evolutionary reversal of character states are: not found but in real life some reversals may occur. Given these character states, we can compare the four species phenetically and cladistically. The phenetic similarity  calculation is based on the number of shared characteristics that are in the derived

 


Related Discussions:- Explain evolutionary classification

Formation of lactate and its consumption, Formation of  lactate and  its ...

Formation of  lactate and  its consumption Formation of  lactate and  its consumption : If anaerobic conctitions prevail, the reoxidation  of NADH  through the respiratory cha

Emulsion products, E m u l s io n products Ground meat products s...

E m u l s io n products Ground meat products such as sausages, patties and luncheon meats are emulsion based products and their quality depends upon the ability of lean m

How much ampicillin can dissolve in 400 ml, How much ampicillin (sodium sal...

How much ampicillin (sodium sal, mw=371.40) would you dissolve in 400 mL of water to make 80 mg/ml solution of ampicillin?

Streptococcal antibody test, In about 80 per cent of ARF patients, ASO titr...

In about 80 per cent of ARF patients, ASO titre is significantly raised. ASO titres vary with age, geographical area and other fevers, which influence frequency of streptococcal in

What is the life cycle type of bryophytes, What is the life cycle type of b...

What is the life cycle type of bryophytes? As in all plants the life cycle of bryophytes is diplobiontic (alternation of generations). In bryophytes the lasting form is the hap

Vacuoles, VACUOLES  Some animals cells may have  one to a few small  fl...

VACUOLES  Some animals cells may have  one to a few small  fluid  filled vacuoles.. Plants  cells  in general  possess one or a few  large vacuoles. Vacuoles  of animals  cells

In how many form glycogen synthase exists, Glycogen  synthase exists  in t...

Glycogen  synthase exists  in two forms:   the phosphorylated form designated  as  'D' form is the  inactive one and  the dephoshorylated form designated as  'I'  form is the activ

Cell, What is suisidel bag in plant?

What is suisidel bag in plant?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd