Explain environmental sampling - methods and techniques, Biology

Assignment Help:

Explain Environmental Sampling - Methods and Techniques?

Environmental sampling can be done for total microbial load or for some specific pathogens or spoilage organisms. The medium used is chosen accordingly. Different media like Brain Heart Infusion (BHI) broth, Plate-count agar with or without antibiotics, Pseudomonas isolation agar etc. can be employed, depending upon the purpose. Criteria for acceptable microbiological results from food contact surfaces depend on the food being processed in the facility. On the basis of nature of the site, degree of contamination and microbiological information sought, different sampling techniques can be employed for processing surfaces and air sampling.


Related Discussions:- Explain environmental sampling - methods and techniques

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Digestive system - tongue, TONGU E - On the tongue 4 types of p...

TONGU E - On the tongue 4 types of papillae are present. (i) Filliform - Filliform papillae are most abundant and have no taste bunds. Filliform papillae

Explain thalamus and hypothalamus, Q. Explain Thalamus and Hypothalamus ? ...

Q. Explain Thalamus and Hypothalamus ? Thalamus and Hypothalamus: The thalamus is situated in the forebrain at the uppermost part of the diencephalon (posterior part of the for

Determine inharmonious intraspecific ecological interaction, Why is canniba...

Why is cannibalism an inharmonious intraspecific ecological interaction? In cannibalism an individual eats other of the same species (occurs in some insects and arachnids). Sin

Neurosecretory cells and neurosecretion, Neurosecretory Cells and Neurosecr...

Neurosecretory Cells and Neurosecretion We have before said that the neurosecretory cells are an important component of the non- chordate endocrine system. Of course, they are

Organic chemistry and macromolecules, identify 7 speccific ways in which yo...

identify 7 speccific ways in which you can diversify carbon-containing compounds

Excretion, State the excretory organelles of various organisms

State the excretory organelles of various organisms

Forebrain - diancephalon, DIANCEPHALO N - Less visible. Occupies on...

DIANCEPHALO N - Less visible. Occupies only 1% of brain's volume. Its lumen is diocoel or III ventricle. Roof is epithalamus . On it pineal body is present. Fl

Obelia, why is obelia considered to of special interest in Zoology as an an...

why is obelia considered to of special interest in Zoology as an animal showing an intermediate grade of organisation?

Explain about the high risk pregnancies, Explain About the High Risk Pregna...

Explain About the High Risk Pregnancies? Until now we have considered the nutritional needs of pregnant women. In this sub-section, we will consider specific conditions that co

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd