Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Environmental Sampling - Methods and Techniques?
Environmental sampling can be done for total microbial load or for some specific pathogens or spoilage organisms. The medium used is chosen accordingly. Different media like Brain Heart Infusion (BHI) broth, Plate-count agar with or without antibiotics, Pseudomonas isolation agar etc. can be employed, depending upon the purpose. Criteria for acceptable microbiological results from food contact surfaces depend on the food being processed in the facility. On the basis of nature of the site, degree of contamination and microbiological information sought, different sampling techniques can be employed for processing surfaces and air sampling.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
TONGU E - On the tongue 4 types of papillae are present. (i) Filliform - Filliform papillae are most abundant and have no taste bunds. Filliform papillae
Q. Explain Thalamus and Hypothalamus ? Thalamus and Hypothalamus: The thalamus is situated in the forebrain at the uppermost part of the diencephalon (posterior part of the for
Why is cannibalism an inharmonious intraspecific ecological interaction? In cannibalism an individual eats other of the same species (occurs in some insects and arachnids). Sin
Neurosecretory Cells and Neurosecretion We have before said that the neurosecretory cells are an important component of the non- chordate endocrine system. Of course, they are
identify 7 speccific ways in which you can diversify carbon-containing compounds
State the excretory organelles of various organisms
DIANCEPHALO N - Less visible. Occupies only 1% of brain's volume. Its lumen is diocoel or III ventricle. Roof is epithalamus . On it pineal body is present. Fl
why is obelia considered to of special interest in Zoology as an animal showing an intermediate grade of organisation?
Explain About the High Risk Pregnancies? Until now we have considered the nutritional needs of pregnant women. In this sub-section, we will consider specific conditions that co
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd