Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Environmental Sampling - Methods and Techniques?
Environmental sampling can be done for total microbial load or for some specific pathogens or spoilage organisms. The medium used is chosen accordingly. Different media like Brain Heart Infusion (BHI) broth, Plate-count agar with or without antibiotics, Pseudomonas isolation agar etc. can be employed, depending upon the purpose. Criteria for acceptable microbiological results from food contact surfaces depend on the food being processed in the facility. On the basis of nature of the site, degree of contamination and microbiological information sought, different sampling techniques can be employed for processing surfaces and air sampling.
Q. Which organs of the body is part of the human digestive system? The digestive system also known as "systema digestorium" or gastrointestinal system is composed of the digest
Meningocele In this the meninges protrude through the opening in the vertebrae generally in the lower back. The sac contains meninges and cerebrospinal fluid. The sac may
Explain briefly why 'greenhouse' gases lead to global warming. The greenhouse gases do not interfere with the short-wave radiation reaching the Earth from the sun but take up t
In the above sections we discussed in detail the fossil record of primates in general and more particularly those of apes and the humans. Despite the fact that in recent years a nu
Explain what is Light Microscope - Microscopy Modern light microscopes are compound microscopes. Here the magnified image formed by the objective lens is further enlarged by on
Q. What are the kinds of fecundation that occur in arthropods? What is the predominant kind? In arthropods there are species having exterior fecundation and other species havin
Soil – plant – animal relationship The plants derive the minerals from soil, and the animals from the plants / feed they consume and there is a dependent interrelationship bet
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Why is it a sturdy evolutionary hypothesis that although viruses are the structurally simplest beings they were not the first living beings? The fact that viruses are obliga
Blastulation Formation of blastula from morula is called as blastulation. During early cleavage the blastomere maintain spherical shape and mulberry like, this stage of emb
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd