Explain environmental sampling - methods and techniques, Biology

Assignment Help:

Explain Environmental Sampling - Methods and Techniques?

Environmental sampling can be done for total microbial load or for some specific pathogens or spoilage organisms. The medium used is chosen accordingly. Different media like Brain Heart Infusion (BHI) broth, Plate-count agar with or without antibiotics, Pseudomonas isolation agar etc. can be employed, depending upon the purpose. Criteria for acceptable microbiological results from food contact surfaces depend on the food being processed in the facility. On the basis of nature of the site, degree of contamination and microbiological information sought, different sampling techniques can be employed for processing surfaces and air sampling.


Related Discussions:- Explain environmental sampling - methods and techniques

Define human digestive system, Q. Which organs of the body is part of the h...

Q. Which organs of the body is part of the human digestive system? The digestive system also known as "systema digestorium" or gastrointestinal system is composed of the digest

Meningocele, Meningocele In this the meninges protrude through the op...

Meningocele In this the meninges protrude through the opening in the vertebrae generally in the lower back. The sac contains meninges and cerebrospinal fluid. The sac may

Why greenhouse gases lead to global warming, Explain briefly why 'greenhous...

Explain briefly why 'greenhouse' gases lead to global warming. The greenhouse gases do not interfere with the short-wave radiation reaching the Earth from the sun but take up t

Hominid phylogeny, In the above sections we discussed in detail the fossil ...

In the above sections we discussed in detail the fossil record of primates in general and more particularly those of apes and the humans. Despite the fact that in recent years a nu

Explain what is light microscope - microscopy, Explain what is Light Micros...

Explain what is Light Microscope - Microscopy Modern light microscopes are compound microscopes. Here the magnified image formed by the objective lens is further enlarged by on

Type of fecundation that occur in arthropods, Q. What are the kinds of fecu...

Q. What are the kinds of fecundation that occur in arthropods? What is the predominant kind? In arthropods there are species having exterior fecundation and other species havin

Soil – plant – animal relationship, Soil – plant – animal relationship ...

Soil – plant – animal relationship The plants derive the minerals from soil, and the animals from the plants / feed they consume and there is a dependent interrelationship bet

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

+illustrate sturdy evolutionary hypothesis, Q. Why is it a sturdy evolution...

Q. Why is it a sturdy evolutionary hypothesis that although viruses are the structurally simplest beings they were not the first living beings? The fact that viruses are obliga

Blastulation, Blastulation  Formation of blastula from morula is called...

Blastulation  Formation of blastula from morula is called as blastulation. During early cleavage the blastomere maintain spherical shape and mulberry like, this stage of emb

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd