Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Electron Volt
Electron Volt: Amount of kinetic energy obtained by an electron, initially at rest, after undergoing an acceleration by a one volt potential difference.
1eV = 1.6 * 10-19 J
Asexual Reproduction - Its Prevalence and Significance Having studied the several aspects of asexual reproduction in the non-chordates we can now make a few generalizations.
Q. What similarities do reptiles and birds share regarding external coverage, reproduction and excretion? Regarding external coverage, birds are similar to reptiles as they pre
Pulse Oximetry: Procedure: Pulse Oximetry is a safe and simple method of assessing oxygenation. An advantage is that this method is noninvasive and continuous. Previously,
How sugar used in Flavors and Mouthfeel? In frozen desserts, sugars balance flavor and mouthfeel. Since low temperatures tend to numb the taste buds, sugars enhance flavors, th
Q. Mammal identity card. How are mammals characterized according to examples of representing beings, skin, respiration, nitrogen waste, basic morphology, circulation, thermal contr
The RER have various proteins which have the role of assisting nascent proteins to fold rightly into their native conformation. Some of these are called as chaperones. RER-resident
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. DNA damaged by alkylating agents? 1. Some simple alkylating agents 2. Illustrations of products of alkylating agents 3.Many of these products can be repaired by excision rep
IN WHAT ASPECT ARE CNIDARIANS SIMILAR TO PROTOZOANS
VITAMIN - C Also known as ascorbic acid / anti viral vitamin / anti cancer vitamin / anti rabies vitamin / anti scurvy vitamin. It is the earliest known vitamin. It
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd