Explain echinocandins, Biology

Assignment Help:

Explain Echinocandins

It inhibit synthesis of β (1,3)-D-glucan, an essential component of the fungal cell wall. The potential for adverse effects in humans is low because of the absence of this substance in mammalian cells. The only echinocandin currently on the market is caspofungin (Cancidas).

 


Related Discussions:- Explain echinocandins

Toxoplasma gondii - protozoan, Toxoplasma gondii Another well known Sp...

Toxoplasma gondii Another well known Sporozoan is Toxoplasma gondii which has an unusually wide host- range for n protozoan parasite. It can probably infect all warm-blooded a

Calcium channel blockers, Calcium antagonists are not recommended for the t...

Calcium antagonists are not recommended for the treatment of CHF because of their negative inotropic effects. However, second-generation dihydropyridine-type calcium antagonists su

What are the illustrations of the civil law, What are the illustrations of ...

What are the illustrations of the civil law? Illustrations of the civil law: Illustrations of civil actions are defamation of breach, character of contract, trespassing or

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

#title a&p, list all of the parts of a generalized cell that might be invol...

list all of the parts of a generalized cell that might be involved support movement coordination respiration digestion transportation excr production making proteins and reproducti

Vasa diffrentia, VAS A DIFFRENTIA - Originate from wollfian duct ....

VAS A DIFFRENTIA - Originate from wollfian duct . It comes out fo cauda epdidymis enters into abdominal cavity through inguinal canal, forms loop round the uretor and j

Explain H - shaped incision, Q. Explain H - Shaped Incision? This type ...

Q. Explain H - Shaped Incision? This type of incision is especially useful for: The anterior maxilla or mandible. Accurately identified implant position. Exposure o

Agro industrial-incriminating factors in feeds, Agro Industrial-Incriminati...

Agro Industrial-Incriminating factors in feeds There are many anti-nutritional factors present in feeds and fodders which affect the utilization of nutrients. Some of these are

What is dna sequencing, DNA sequencing is the process of reading the nucleo...

DNA sequencing is the process of reading the nucleotide bases in a DNA molecule. It includes any technology or method which is used to verify the order of the four bases- guanine,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd