Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
DIGESTION
Digestive enzymes break down food particles into smaller units. You will see that the final breakdown products of protein digestion are single amino acids or small chains of two or three amino acids. The final products of carbohydrate digestion are monosaccharides. The final digestive products of triacylglycerol digestion are free fatty acids and glycerol and monoacylglycerols. Vitamins, minerals, water and some larger fat-like compounds such as cholesterol are not broken down before they are absorbed. Where does the digestion of food occur in our body? Obviously, it occurs in the digestive system. You may recall reading about the anatomy of the digestive system in the Applied Physiology Course, Unit 6. If you have not gone through this Unit, we suggest you read the Unit now, as it will help in understanding the concepts explained in this Unit. The human digestive system is a coiled, muscular tube (6-9 meters long when fully extended) extending from the mouth to the anus. Several specialized compartments occur along this length- mouth, pharynx, orsophagus, stomach, small intestine, large intestine and anus.
what are the two main pollutants that contribute to acid rain
MORPHOLOGICAL AND ANATOMICAL EVIDENCES - (i ) HOMOLOGOUS ORGANS - The organs apparently similar or dissimilar in structure and function, but of similar embryonic origi
Physical Weathering Mechanical forces acting upon the rocks cause physical weathering. Temperature fluctuations cause expansion and contraction of rock surface resulting in the
Protoplasmic Streaming and Tubular Peristaltic Flow Model The first of the above two models involves the well known phenomenon of cytoplasmic streaming in giant algal cells. C
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In Chemical Reactions that have a large negative /\Go' a- the total amount of both reactants and products decreases b- the products are less stable than the reactants c- t
Visceral larva migrans Visceral larva migrans, also known as larval granulomatosis, is a clinical syndrome produced by the extra-intestinal migration of larval nematodes and i
Explain what is Light Microscope - Microscopy Modern light microscopes are compound microscopes. Here the magnified image formed by the objective lens is further enlarged by on
Q. Which is the kind of muscle tissue that helps to push the food down through the esophagus? The esophageal wall in its superior portion is made of skeletal striated muscle th
Pathology: This concerned with the identification of different diseases, causative organs, their prevention and control methods. Pathology is a kind of study or diagnosis of diseas
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd