Explain digestion system, Biology

Assignment Help:

DIGESTION

Digestive enzymes break down food particles into smaller units. You will see  that the final breakdown products of protein digestion are single amino acids or small chains of  two  or  three amino  acids.  The  final products  of  carbohydrate digestion  are monosaccharides. The  final digestive products of triacylglycerol digestion are  free fatty acids and glycerol  and monoacylglycerols. Vitamins, minerals, water and some larger fat-like compounds such as cholesterol are not  broken  down before  they are absorbed. Where  does the  digestion of  food  occur  in  our  body? Obviously,  it  occurs  in  the digestive system. You may recall reading about the anatomy of the digestive system in  the Applied Physiology Course, Unit 6. If you have not gone through this Unit, we suggest  you read  the Unit  now,  as  it  will help  in  understanding  the  concepts explained  in  this Unit. The human  digestive system is a coiled, muscular tube (6-9 meters  long when  fully extended) extending  from  the mouth  to  the  anus.  Several specialized compartments occur  along  this  length- mouth, pharynx,  orsophagus, stomach, small intestine, large intestine and anus.

 


Related Discussions:- Explain digestion system

Acid rain, what are the two main pollutants that contribute to acid rain

what are the two main pollutants that contribute to acid rain

Morphological and anatomical evidences of evolution, MORPHOLOGICAL AND ANAT...

MORPHOLOGICAL AND ANATOMICAL EVIDENCES - (i ) HOMOLOGOUS ORGANS - The organs apparently similar or dissimilar in structure and function, but of similar embryonic origi

Physical weathering-weathering of rocks, Physical Weathering Mechanical...

Physical Weathering Mechanical forces acting upon the rocks cause physical weathering. Temperature fluctuations cause expansion and contraction of rock surface resulting in the

Protoplasmic streaming and tubular peristaltic flow model, Protoplasmic Str...

Protoplasmic Streaming and Tubular Peristaltic Flow Model The first of the above two models involves the well known phenomenon of cytoplasmic streaming in giant algal cells. C

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is total amount of both reactants and products decrease, In Chemical R...

In Chemical Reactions that have a large negative /\Go' a- the total amount of both reactants and products decreases b- the products are less stable than the reactants c- t

Visceral larva migrans, Visceral larva migrans Visceral larva migrans,...

Visceral larva migrans Visceral larva migrans, also known as larval granulomatosis, is a clinical syndrome produced by the extra-intestinal migration of larval nematodes and i

Explain what is light microscope - microscopy, Explain what is Light Micros...

Explain what is Light Microscope - Microscopy Modern light microscopes are compound microscopes. Here the magnified image formed by the objective lens is further enlarged by on

Push the food down through the esophagus, Q. Which is the kind of muscle ti...

Q. Which is the kind of muscle tissue that helps to push the food down through the esophagus? The esophageal wall in its superior portion is made of skeletal striated muscle th

Pathology, Pathology: This concerned with the identification of different d...

Pathology: This concerned with the identification of different diseases, causative organs, their prevention and control methods. Pathology is a kind of study or diagnosis of diseas

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd