Explain difference between monosaccharides and disaccharides, Biology

Assignment Help:

What is the difference between monosaccharides and disaccharides? What are some examples of disaccharides and of monosaccharides that form them?

Monosaccharides are simple molecules of carbohydrates that cannot be broken into other carbohydrates. Glucose and fructose are instance of monosaccharides. Disaccharides are carbohydrates made of two monosaccharides and with the loss of one molecule of water (dehydration). The chemical bond among two monosaccharides is called as a glycosidic bond.

Sucrose (table sugar) is a disaccharide made by the union of one molecule of glucose with one molecule of fructose. Maltose is a disaccharide made by two glucose molecules. Lactose (milk sugar) is another disaccharide and it is formed by the union of one molecule of galactose with one molecule of glucose.

 


Related Discussions:- Explain difference between monosaccharides and disaccharides

Secretory proteins, Proteins destined to be secreted from the eukaryotic ce...

Proteins destined to be secreted from the eukaryotic cell are synthesized by ribosomes bound to the RER (rough endoplasmic reticulum). As the protein is synthesized it is transloca

Biochemistery., how i prepare my best assignment on DNA Polymerase 1 2 and ...

how i prepare my best assignment on DNA Polymerase 1 2 and 3

Explain the peripheral nervous system in detail, Explain The Peripheral Ner...

Explain The Peripheral Nervous System in detail? The peripheral nervous system is divided into the somatic nervous system and the autonomic nervous system. The somatic nervous

Adenosine diphosphate (adp), ADP is lower energy form of ATP, containing tw...

ADP is lower energy form of ATP, containing two (in spite of the three in ATP) phosphate groups attached to the adenine base and ribose sugar.

What is population growth rate, Q. What is population growth rate? The ...

Q. What is population growth rate? The Population growth rate (PGR) is the percent variation between the numbers of individuals in a population at two different times. Thus the

Explain the mechanical requirements of implant materials, Mechanical requir...

Mechanical requirements of implant materials Dental implant s must be able to sustain and transfer loads -It should have adequate mechanical strength in order to distribute th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Current approach of liberal management in peptic ulcer, Q. Current approach...

Q. Current approach of liberal management in peptic ulcer? Current approach of liberal management in peptic ulcer medical nutrition therapy postulates: It is the individual pat

Which are the organs of the excretory system, Q. Which are the organs of th...

Q. Which are the organs of the excretory system? The excretory system is formed of ureters (two), kidneys (two), bladder and urethra.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd