Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the difference between monosaccharides and disaccharides? What are some examples of disaccharides and of monosaccharides that form them?
Monosaccharides are simple molecules of carbohydrates that cannot be broken into other carbohydrates. Glucose and fructose are instance of monosaccharides. Disaccharides are carbohydrates made of two monosaccharides and with the loss of one molecule of water (dehydration). The chemical bond among two monosaccharides is called as a glycosidic bond.
Sucrose (table sugar) is a disaccharide made by the union of one molecule of glucose with one molecule of fructose. Maltose is a disaccharide made by two glucose molecules. Lactose (milk sugar) is another disaccharide and it is formed by the union of one molecule of galactose with one molecule of glucose.
Proteins destined to be secreted from the eukaryotic cell are synthesized by ribosomes bound to the RER (rough endoplasmic reticulum). As the protein is synthesized it is transloca
how i prepare my best assignment on DNA Polymerase 1 2 and 3
Explain The Peripheral Nervous System in detail? The peripheral nervous system is divided into the somatic nervous system and the autonomic nervous system. The somatic nervous
example of outline f coelenterata
ADP is lower energy form of ATP, containing two (in spite of the three in ATP) phosphate groups attached to the adenine base and ribose sugar.
Q. What is population growth rate? The Population growth rate (PGR) is the percent variation between the numbers of individuals in a population at two different times. Thus the
Mechanical requirements of implant materials Dental implant s must be able to sustain and transfer loads -It should have adequate mechanical strength in order to distribute th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Current approach of liberal management in peptic ulcer? Current approach of liberal management in peptic ulcer medical nutrition therapy postulates: It is the individual pat
Q. Which are the organs of the excretory system? The excretory system is formed of ureters (two), kidneys (two), bladder and urethra.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd