Explain diabetes mellitus, Biology

Assignment Help:

Diabetes mellitm

This anabolic hormone exerts its action on key glycolytic  enzymes  thus  leading  to the conversion of glucose  to  pyruvate as explained under the regulation of glycolysis. On the other hand, insulin suppresses the action of all key gluconeogenic enzymes. With respect to glycogen metabolism,  the excess glucose is converted  to glycogen by activating  glycogen synthase  thus leading  to glycogenesis  and inhibiting glycogenolysis. In this metabolic disease-diabetes mellitus, the lack of  insulin reverses these actions  and the antagonistic hormones  (like  glucagon, epinephrine, catecholamines, thyroxine  etc.)  by their concerted efforts  on various ~athwavs  brine:  about  the hyperglycemic condition.

 

 


Related Discussions:- Explain diabetes mellitus

Points, What is the classification of protozoa with examples

What is the classification of protozoa with examples

Compare between mummers of dna vs monomers of rna, Name few polymers in the...

Name few polymers in the eukoratic cell? Name the mummers that make up the DNA? Compare and contrast between mummers of DNA VS monomers of RNA?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the basic structure of the hiv virus, What is the basic structure o...

What is the basic structure of the HIV virus? What is the function of the glycoproteins of its envelope? HIV is an RNA virus. In its core there are two strands of RNA and reve

Which of mendel''s postulates demonstrated in crosses, Which of Mendel's po...

Which of Mendel's postulates can only be demonstrated in crosses involving at least two pairs of traits? a) Segregation b) dominance/recessiveness c) independent assortment d) unit

Whcih animals are triploblastic, Which one of the following kinds of animal...

Which one of the following kinds of animals are triploblastic? 1. Flat worms 2. Sponges 3. Ctenophores 4. Corals Flat worms

What is the reason for the low red blood cell count, A patient has a low re...

A patient has a low red blood cell count, and microscopic examination reveals an abnormally high proportion of circulating reticulocytes. Upon subsequent examination, the patient i

Conditions essential for the germination of seeds, To study the conditions ...

To study the conditions essential for the germination of seeds:- In the diagram below a having seeds on cotton wool with air, warmth, but no water; b has water, warmth, but no

Determination of the age of fossil, DETERMIN A TIO N OF THE AGE OF FOSSI...

DETERMIN A TIO N OF THE AGE OF FOSSIL - Radioactive clock (Boltwood -1907) - Half life of uranium is 4.5 billion years. This means half of total uranium disintegrates

Explain economic status of diet, Economic Status Economic Status  :  I...

Economic Status Economic Status  :  It is one of the important practical considerations to be kept in mind while  formulating  a diet prescription. During  an acute illness, a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd