Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Diabetes mellitm
This anabolic hormone exerts its action on key glycolytic enzymes thus leading to the conversion of glucose to pyruvate as explained under the regulation of glycolysis. On the other hand, insulin suppresses the action of all key gluconeogenic enzymes. With respect to glycogen metabolism, the excess glucose is converted to glycogen by activating glycogen synthase thus leading to glycogenesis and inhibiting glycogenolysis. In this metabolic disease-diabetes mellitus, the lack of insulin reverses these actions and the antagonistic hormones (like glucagon, epinephrine, catecholamines, thyroxine etc.) by their concerted efforts on various ~athwavs brine: about the hyperglycemic condition.
VARI A TION S - Defined as "dissimilarities of features among members of the same species". Offsprings of same parent are different and also differ from their parent.
What is xaxim? Most pteridophytes have subterraneous stems parallel to the substrate known as rhizomes. Xaxim is a type of pteridophyte with an aerial stem generally perpendicu
Hemicellulose In plant cell walls, the most abundant compound present is α-cellulose with long fibers embedded in a matrix of cementing compounds (matrix polysaccharides). Thes
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
A monohybrid cross: A.Determines the genetic makeup of an organism B.always involves homozygous alleles. C.always involves organisms that are heterozygous at all loci. D.Always inv
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Vitamins differ from minerals in that vitamins are compounds, and not elements. Vitamins do not help form bodily structures and thus are needed strictly in small quantities-sometim
Describe about the role of plant breeding in crop improvement?
Q. What is cerumen? Cerumen is a fatty, oily substance produced by theceruminous glands in outer part of ear canal. This compound is generally referred to as ear wax and, toget
Metabolic Events Let us now examine the changes that occur in the seeds after they imbibe water. In general, the most important metabolic events are: Degradation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd