Explain diabetes mellitus, Biology

Assignment Help:

Diabetes mellitm

This anabolic hormone exerts its action on key glycolytic  enzymes  thus  leading  to the conversion of glucose  to  pyruvate as explained under the regulation of glycolysis. On the other hand, insulin suppresses the action of all key gluconeogenic enzymes. With respect to glycogen metabolism,  the excess glucose is converted  to glycogen by activating  glycogen synthase  thus leading  to glycogenesis  and inhibiting glycogenolysis. In this metabolic disease-diabetes mellitus, the lack of  insulin reverses these actions  and the antagonistic hormones  (like  glucagon, epinephrine, catecholamines, thyroxine  etc.)  by their concerted efforts  on various ~athwavs  brine:  about  the hyperglycemic condition.

 

 


Related Discussions:- Explain diabetes mellitus

Variations, VARI A TION S - Defined as "dissimilarities of featur...

VARI A TION S - Defined as "dissimilarities of features among members of the same species". Offsprings of same parent are different and also differ from their parent.

What is xaxim, What is xaxim? Most pteridophytes have subterraneous ste...

What is xaxim? Most pteridophytes have subterraneous stems parallel to the substrate known as rhizomes. Xaxim is a type of pteridophyte with an aerial stem generally perpendicu

Explain hemicellulose, Hemicellulose In plant cell walls, the most abun...

Hemicellulose In plant cell walls, the most abundant compound present is α-cellulose with long fibers embedded in a matrix of cementing compounds (matrix polysaccharides). Thes

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

A monohybrid cross, A monohybrid cross: A.Determines the genetic makeup of ...

A monohybrid cross: A.Determines the genetic makeup of an organism B.always involves homozygous alleles. C.always involves organisms that are heterozygous at all loci. D.Always inv

Green glands of crustaceans, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Vitamins - digestion process, Vitamins differ from minerals in that vitamin...

Vitamins differ from minerals in that vitamins are compounds, and not elements. Vitamins do not help form bodily structures and thus are needed strictly in small quantities-sometim

Plant breeding, Describe about the role of plant breeding in crop improveme...

Describe about the role of plant breeding in crop improvement?

What is cerumen, Q. What is cerumen? Cerumen is a fatty, oily substance...

Q. What is cerumen? Cerumen is a fatty, oily substance produced by theceruminous glands in outer part of ear canal. This compound is generally referred to as ear wax and, toget

Metabolic events, Metabolic Events Let us now examine the changes that...

Metabolic Events Let us now examine the changes that occur in the seeds after they imbibe water. In general, the most important metabolic events are: Degradation

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd