Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Diabetes mellitm
This anabolic hormone exerts its action on key glycolytic enzymes thus leading to the conversion of glucose to pyruvate as explained under the regulation of glycolysis. On the other hand, insulin suppresses the action of all key gluconeogenic enzymes. With respect to glycogen metabolism, the excess glucose is converted to glycogen by activating glycogen synthase thus leading to glycogenesis and inhibiting glycogenolysis. In this metabolic disease-diabetes mellitus, the lack of insulin reverses these actions and the antagonistic hormones (like glucagon, epinephrine, catecholamines, thyroxine etc.) by their concerted efforts on various ~athwavs brine: about the hyperglycemic condition.
What is the classification of protozoa with examples
Name few polymers in the eukoratic cell? Name the mummers that make up the DNA? Compare and contrast between mummers of DNA VS monomers of RNA?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the basic structure of the HIV virus? What is the function of the glycoproteins of its envelope? HIV is an RNA virus. In its core there are two strands of RNA and reve
Which of Mendel's postulates can only be demonstrated in crosses involving at least two pairs of traits? a) Segregation b) dominance/recessiveness c) independent assortment d) unit
Which one of the following kinds of animals are triploblastic? 1. Flat worms 2. Sponges 3. Ctenophores 4. Corals Flat worms
A patient has a low red blood cell count, and microscopic examination reveals an abnormally high proportion of circulating reticulocytes. Upon subsequent examination, the patient i
To study the conditions essential for the germination of seeds:- In the diagram below a having seeds on cotton wool with air, warmth, but no water; b has water, warmth, but no
DETERMIN A TIO N OF THE AGE OF FOSSIL - Radioactive clock (Boltwood -1907) - Half life of uranium is 4.5 billion years. This means half of total uranium disintegrates
Economic Status Economic Status : It is one of the important practical considerations to be kept in mind while formulating a diet prescription. During an acute illness, a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd