Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Dextran
Dextran is a high molecular weight polysaccharide having α1→ 6, α1→ 3 linked glucans. It is produced by the bacterial fermentation of sucrose by Leuconostoc dextranicum followed by partial depolymerisation and purification of the fermented mixture to produce a substance that is free of viable micro organisms.
Dextran is a fine, white powder that dissolves readily in hot or cold water to give a clean and viscous solution. It has good humectant and water-holding properties and imparts good bodying attributed to liquid systems.
What two biotic factors could affect an antelope living in the Serengeti? The biotic factors that may affect an antelope living in the Serengeti could be:predation by carnivore
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Light in cell Metabolism? Energy for almost all organisms on earth is derived directly or indirectly from light energy produced by the sun. Sunlight consists of energy
There are two main sources of pollution: (1). Natural Sources: (a) Volcanic ash (b) Marsh gas (CH4) released from decay of organic matter.
Br u c e ll osi s It is also called as Bang's disease or contagious abortion as it causes abortion in late pregnancy and infertility. E t iology: It is cause
Thorax and Lungs: The lungs, a pair of conical-shaped organs lie in the thoracic cavity, protected by the bony thorax composed of the sternum and ribs a interiorly and r
name the blood vessel which bring waste product to kidney
What are the five human digestive secretions? Which of them is the only one that does not contain digestive enzymes? The human digestive secretions such as: saliva, gastric jui
what is omn viva ex ova?
Homologous structures are the body parts in different organisms which have similar bones and similar arrangements of the blood vessels, muscles, and nerves and go through similar
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd